Drag and drop file hereLimit 200MB per file • JSON
Sending request
Processing results from the server
| Contig | Start | Stop | Target | Context | Overflow_X | Orientation_X | Otcount_X | Doench2014Ontarget | Doenchcfd_Maxot | Doenchcfd_Specificityscore | Dangerous_Gc | Dangerous_Polyt | Dangerous_In_Genome | Hsu2013 | Basesdifftoclosesthit | Closesthitcount | 0-1-2-3-4_Mismatch | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | sequence_0 | 0 | 23 | GAGAATCAAAATCGGTGAATNGG | NONE | OK | FWD | 143 | NaN | 0.4875 | 0.054706 | NONE | NONE | IN_GENOME=1 | 84.202203 | 3 | 5 | 1,0,0,5,137 |
| Off Target ID | crRNA | DNA | Chromosome | Start | End | Strand | Mismatches | Gene Type | Feature | Gene Ensembl Id | Gene Symbol | OMIM Phenotype | OMIM Inheritance Model | Role in Cancer | MiRNA gene | Pfam Protein Domains | TargetScan | HumanTF Source | Expression Information | Rbp Gene | Promoter of Gene (ENSG) | Gene(Promoter) Phenotype | Gene(Promoter) Inheritance model | Gene(Promoter) Role in Cancer | Enhancer of Gene (ENSG) | Gene(Enhancer) Phenotype | Gene(Enhancer) Inheritance Model | Gene(Enhancer) Role in Cancer | Risk_Score | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 0 | GAGAATCAAAATCGGTGAATNGG | AAAAAACAAAATCAGTGAATTGG | 5 | 68208929 | 68208952 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 1 | 1 | GAGAATCAAAATCGGTGAATNGG | AAAAACCAAAATCGGTGTATCGG | 10 | 8060818 | 8060841 | - | 4 | ['protein_coding'] | transcript | ENSG00000107485 | GATA3 | Hypoparathyroidism, sensorineural deafness, and renal dysplasia, 146255 (3) | Autosomal dominant | oncogene, TSG | NaN | NaN | NaN | TF | GATA3:(2,1,1,1,2,1,1,1,1,1,2,1,2,1,2,2,5,2,1,1,1,1,1,1,2,2,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,1,2,1,2,2,1,2,1,1,1,2,1,1,1,1,1,1,1,1,2,1,1,2,2,2,2,4,2,1,1,1,1,2,1,2,2,2,2,2,5,1,4,3,5,2,2,2,2,1,1,1,2,2,2,1,1,1,1,1,1,2,2,2,2,2,2,4,1,1,1,1,1,1,1,4,2,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,2,4,2,1,1,4,2,4,4,1,2,2,1,2,1,1,4,4,2,3,2,1,2,2,2,4,1,2,1,2,2,1,4,4,2,1,2,1,1,1,1,2,1,1,2,2,2,2,1,2,1,2,2,2,2,3,2,1,1,1,1,1,1,1,2,2,2,2,5,3) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 2 | 2 | GAGAATCAAAATCGGTGAATNGG | AAAAATCAATATCTGTGAATGGG | 14 | 87782817 | 87782840 | + | 4 | ['lncRNA'] | transcript | ENSG00000258807 | ENSG00000258807 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 3 | 3 | GAGAATCAAAATCGGTGAATNGG | AAGAAAAAAAATAGGTGAATTGG | 9 | 77194978 | 77195001 | - | 4 | ['protein_coding'] | transcript | ENSG00000197969 | VPS13A | Choreoacanthocytosis, 200150 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | VPS13A:(4,1,1,1,4,1,1,1,1,1,4,1,3,1,3,3,4,4,1,1,1,1,1,1,4,3,3,1,1,1,1,3,1,1,1,3,3,1,1,1,1,1,1,1,1,1,1,1,1,3,3,3,1,3,1,1,3,1,4,1,1,1,4,1,1,4,1,1,1,1,1,4,1,1,2,3,2,4,4,3,1,1,1,1,3,1,4,4,3,4,1,3,5,1,1,1,1,2,4,1,4,4,4,4,4,4,1,1,1,1,1,1,4,2,1,2,3,4,4,1,1,3,1,1,1,1,3,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,3,3,2,3,1,1,1,1,1,1,1,1,4,1,1,3,1,1,3,1,1,1,1,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,2,1,3,1,1,3,1,4,3,4,4,5,1,2,5,2,2,2,5,5,3,4,3,3,4,2) | [] | NaN | [''] | [''] | [''] | ENSG00000197969 | ['Choreoacanthocytosis, 200150 (3)'] | ['Autosomal recessive'] | [''] | Low_coding |
| 4 | 4 | GAGAATCAAAATCGGTGAATNGG | AAGAAACAAAAACGGTGAGTTGG | 8 | 10616436 | 10616459 | - | 4 | ['protein_coding'] | exon | ENSG00000183638 | RP1L1 | Retinitis pigmentosa 88, 618826 (3), ; Occult macular dystrophy, 613587 (3) | Autosomal dominant Autosomal recessive | NaN | NaN | NaN | NaN | NaN | RP1L1:(2,1,1,1,2,1,1,1,1,1,2,1,2,1,2,2,2,2,1,1,1,1,1,1,2,2,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,1,2,1,2,2,1,2,1,1,1,2,1,1,2,1,1,1,1,1,2,1,1,2,2,2,2,2,2,1,1,1,1,2,1,2,2,2,2,1,2,2,1,1,1,1,2,2,2,1,1,1,2,2,2,1,1,1,1,1,1,2,2,2,2,2,2,2,1,1,2,1,1,1,1,2,2,1,1,1,1,1,2,1,1,1,2,2,2,2,2,2,5,2,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,2,2,2,2,1,2,2,2,2,2,2,2,2,1,1,1,1,1,1,1,2,2,2,2,2,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | High_coding |
| 5 | 5 | GAGAATCAAAATCGGTGAATNGG | AAGAATAAAAATTGATGAATTGG | 2 | 94883894 | 94883917 | - | 4 | ['lncRNA'] | transcript | ENSG00000291025 | ENSG00000291025 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 6 | 6 | GAGAATCAAAATCGGTGAATNGG | AAGAATAAAAATTGATGAATTGG | 20 | 30730658 | 30730681 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 7 | 7 | GAGAATCAAAATCGGTGAATNGG | AAGAATAAAAATTGATGAATTGG | 21 | 9061991 | 9062014 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 8 | 8 | GAGAATCAAAATCGGTGAATNGG | AAGAATAAAAATTGATGAATTGG | 9 | 64065513 | 64065536 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 9 | 9 | GAGAATCAAAATCGGTGAATNGG | AAGAATAAAAATTGATGAATTGG | 14_GL000194v1_random | 47217 | 47240 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 10 | 10 | GAGAATCAAAATCGGTGAATNGG | AAGAATCAAAATCCTTGAAATGG | Y | 4645389 | 4645412 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 11 | 11 | GAGAATCAAAATCGGTGAATNGG | AAGAATCAAAATCCTTGAAATGG | X | 91181637 | 91181660 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 12 | 12 | GAGAATCAAAATCGGTGAATNGG | AAGAATCAACATCGTTGAAAGGG | 6 | 87271027 | 87271050 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 13 | 13 | GAGAATCAAAATCGGTGAATNGG | AAGAATCAATATCAGTGAAATGG | 8 | 25724535 | 25724558 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 14 | 14 | GAGAATCAAAATCGGTGAATNGG | AAGAATCAATATCGTTGAAATGG | 13 | 86322610 | 86322633 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 15 | 15 | GAGAATCAAAATCGGTGAATNGG | AAGAATCATTATCGGTAAATTGG | 16 | 85555199 | 85555222 | - | 4 | ['protein_coding'] | transcript | ENSG00000131149 | GSE1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | GSE1:(2,1,1,1,2,1,1,1,1,1,3,1,1,1,3,1,3,2,1,1,1,1,1,1,5,2,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,5,2,3,1,2,1,1,4,1,4,1,1,1,3,1,1,1,1,1,1,1,1,3,1,1,2,2,2,2,4,3,1,1,1,1,4,1,3,2,2,2,1,4,3,1,1,1,1,2,2,3,1,1,1,2,2,2,1,1,1,1,1,1,5,3,2,2,3,3,2,1,1,5,1,1,1,1,5,3,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,5,2,3,2,1,1,1,1,1,1,1,1,2,1,1,3,1,1,2,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,1,3,1,1,2,1,2,1,1,2,1,2,1,2,3,2,4,1,1,1,1,1,1,1,4,2,2,4,2,4) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 16 | 16 | GAGAATCAAAATCGGTGAATNGG | AAGTATAAAAATCGGTGAAAGGG | 21 | 35354568 | 35354591 | - | 4 | ['protein_coding'] | transcript | ENSG00000159216 | RUNX1 | Platelet disorder, familial, with associated myeloid malignancy, 601399 (3), ; Leukemia, acute myeloid, 601626 (3), Somatic mutation | Autosomal dominant | oncogene, TSG, fusion | NaN | NaN | NaN | TF | RUNX1:(2,1,1,1,3,1,1,1,1,1,3,1,4,1,4,2,4,4,4,4,2,2,2,2,1,2,3,1,1,1,1,3,1,1,1,2,3,1,1,1,1,1,1,1,1,1,1,1,1,2,2,3,1,2,1,4,2,1,2,1,1,1,3,1,1,1,1,1,1,1,1,4,1,1,3,3,3,3,3,2,4,2,2,2,1,2,3,3,2,3,1,2,3,1,1,1,1,2,2,1,4,4,2,4,4,4,5,5,2,2,2,2,1,2,1,3,2,3,2,1,1,4,1,1,1,1,3,3,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,3,2,2,1,1,2,2,2,2,5,2,2,1,3,4,1,2,5,2,1,2,1,2,2,2,2,1,2,1,2,3,1,2,5,2,1,2,1,1,1,1,4,1,1,2,1,4,2,1,2,1,4,3,4,4,3,3,1,1,1,1,1,1,1,3,4,4,4,4,3) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 17 | 17 | GAGAATCAAAATCGGTGAATNGG | AATAATCAAAATCCGTGAAAAGG | 14 | 80418379 | 80418402 | - | 4 | ['lncRNA'] | transcript | ENSG00000258766 | DIO2-AS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 18 | 18 | GAGAATCAAAATCGGTGAATNGG | ACGAATTAAAATTGGTGAATTGG | 2 | 187831089 | 187831112 | + | 4 | ['lncRNA'] | transcript | ENSG00000231689 | LINC01090 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 19 | 19 | GAGAATCAAAATCGGTGAATNGG | ATCAATCAAATTCGGTGAATTGG | 10 | 8808663 | 8808686 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 20 | 20 | GAGAATCAAAATCGGTGAATNGG | CAGAAGAAAAATCGATGAATTGG | 11 | 62438670 | 62438693 | - | 4 | ['protein_coding'] | transcript | ENSG00000124942 | AHNAK | NaN | NaN | NaN | NaN | NaN | NaN | NaN | AHNAK:(4,1,1,1,2,1,1,1,1,1,3,1,3,1,4,5,5,5,1,1,1,1,1,1,4,3,2,1,1,1,1,2,1,1,1,2,3,1,1,1,1,1,1,1,1,1,1,1,1,5,3,2,1,3,1,5,1,1,4,1,1,1,4,1,1,5,1,1,1,1,1,4,1,1,5,5,5,5,4,5,1,1,1,1,5,1,5,4,3,3,1,5,5,1,1,1,1,4,3,4,1,1,1,4,3,5,1,1,1,1,1,1,4,4,5,4,4,2,4,1,1,5,1,1,1,1,5,5,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,4,5,4,5,1,1,1,1,1,1,1,1,4,1,1,5,1,1,5,1,1,1,1,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,1,5,1,1,4,1,4,4,1,5,1,5,5,5,4,4,2,1,1,1,1,1,1,1,4,3,5,5,5,5) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 21 | 21 | GAGAATCAAAATCGGTGAATNGG | CAGAATAAAACTCGGTGAACAGG | 7 | 110843608 | 110843631 | + | 4 | ['protein_coding'] | transcript | ENSG00000184903 | IMMP2L | NaN | NaN | NaN | NaN | NaN | NaN | NaN | IMMP2L:(4,1,1,1,4,1,1,1,1,1,4,1,4,1,4,3,5,3,1,1,1,1,1,1,4,4,4,1,1,1,1,4,1,1,1,4,4,1,1,1,1,1,1,1,1,1,1,1,1,2,4,4,1,4,1,5,5,1,4,1,1,1,4,1,1,4,1,1,1,1,1,4,1,1,3,5,2,4,5,4,1,1,1,1,5,1,4,4,3,4,1,3,4,1,1,1,1,3,4,4,1,1,1,4,4,4,1,1,1,1,1,1,4,4,5,4,4,4,5,1,1,4,1,1,1,1,5,5,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,4,5,3,4,1,1,1,1,1,1,1,1,4,1,1,4,1,1,4,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,4,4,4,4,1,4,4,4,4,4,4,5,1,5,5,2,4,5,3,4,4,4,5,5,4,4) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 22 | 22 | GAGAATCAAAATCGGTGAATNGG | CAGAATCATAATACGTGAATTGG | 3 | 80655304 | 80655327 | - | 4 | ['lncRNA'] | transcript | ENSG00000286329 | ENSG00000286329 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 23 | 23 | GAGAATCAAAATCGGTGAATNGG | CAGCTTCAAAATCTGTGAATGGG | 2 | 129252225 | 129252248 | - | 4 | ['lncRNA'] | transcript | ENSG00000204460 | LINC01854 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 24 | 24 | GAGAATCAAAATCGGTGAATNGG | CTGAATCAAAATCAGTGAAGTGG | 2 | 70721232 | 70721255 | - | 4 | ['protein_coding'] | transcript | ENSG00000075340 | ADD2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ADD2:(2,1,1,1,3,1,1,1,1,1,2,1,3,1,5,2,2,2,1,1,1,1,1,1,3,2,2,2,2,2,2,1,2,2,2,1,1,2,2,3,2,2,2,4,4,2,5,2,2,2,3,3,1,5,1,3,2,1,2,1,1,1,2,1,1,3,1,1,1,1,1,2,1,1,2,2,2,2,2,2,1,1,1,1,3,1,2,2,2,4,1,2,2,1,1,1,1,2,2,2,1,1,1,2,2,3,1,1,1,1,1,1,3,2,1,2,2,2,2,1,1,2,1,1,1,1,2,2,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,2,1,2,3,1,2,3,2,2,2,2,2,3,1,1,1,1,1,1,1,3,2,3,2,3,2) | [] | NaN | [''] | [''] | [''] | ENSG00000152672 | [''] | [''] | [''] | Low_coding |
| 25 | 25 | GAGAATCAAAATCGGTGAATNGG | GAAAAGCAAAATAGGTGAATGGG | 1 | 4888228 | 4888251 | - | 3 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 26 | 26 | GAGAATCAAAATCGGTGAATNGG | GAAAATAAAAATCTCTGAATGGG | 3 | 55242453 | 55242476 | + | 4 | ['lncRNA'] | transcript | ENSG00000240708 | LINC02030 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 27 | 27 | GAGAATCAAAATCGGTGAATNGG | GAAAATAAAAATGAGTGAATAGG | 20 | 9405588 | 9405611 | + | 4 | ['protein_coding'] | transcript | ENSG00000101333 | PLCB4 | Auriculocondylar syndrome 2, 614669 (3) | Autosomal dominant Autosomal recessive | NaN | NaN | NaN | NaN | NaN | PLCB4:(2,1,1,1,3,1,1,1,1,1,4,1,2,1,2,2,2,2,2,3,3,3,3,2,1,2,4,1,1,1,1,3,1,1,1,3,4,1,1,1,1,1,1,1,1,1,1,1,1,2,2,4,1,3,1,2,3,1,2,1,1,1,4,1,1,2,1,1,1,1,1,4,1,1,2,2,2,2,4,2,2,2,4,4,1,2,3,3,2,3,1,2,3,1,1,1,1,2,3,2,1,1,1,3,2,4,2,3,2,2,4,4,1,2,1,2,4,3,4,1,1,3,1,1,1,1,2,3,1,1,1,1,1,4,1,1,1,3,2,3,2,3,3,5,2,3,2,2,4,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,3,1,1,3,2,2,2,1,2,2,4,2,4,4,4,4,1,1,1,1,1,1,1,3,3,4,3,3,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 28 | 28 | GAGAATCAAAATCGGTGAATNGG | GAAAATAAAAGTGGGTGAATTGG | X | 119688103 | 119688126 | + | 4 | ['protein_coding'] | transcript | ENSG00000125354 | SEPTIN6 | NaN | NaN | fusion | NaN | NaN | NaN | NaN | SEPTIN6:(2,1,1,1,4,1,1,1,1,1,4,1,5,1,5,2,3,2,1,1,1,1,1,1,5,2,3,1,1,1,1,3,1,1,1,2,3,1,1,1,1,1,1,1,1,1,1,1,1,2,2,3,1,3,1,2,1,1,2,1,1,1,4,1,1,2,1,1,1,1,1,5,1,1,2,3,2,3,4,2,1,1,1,1,4,1,5,2,2,3,1,2,5,1,1,1,1,5,4,2,1,1,1,4,5,5,1,1,1,1,1,1,4,2,1,2,2,3,3,1,1,1,1,1,1,1,3,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,2,1,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,5,1,1,2,2,2,2,1,2,2,4,5,5,5,4,3,1,1,1,1,1,1,1,3,5,5,2,4,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 29 | 29 | GAGAATCAAAATCGGTGAATNGG | GAAAATCAAAATGGGTTAGTAGG | 4 | 149997362 | 149997385 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 30 | 30 | GAGAATCAAAATCGGTGAATNGG | GAAAATCAAATTAGTTGAATGGG | 9 | 17903030 | 17903053 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 31 | 31 | GAGAATCAAAATCGGTGAATNGG | GAAAATCTAAATAGGTGAAAAGG | 15 | 74016587 | 74016610 | + | 4 | ['protein_coding'] | transcript | ENSG00000140464 | PML | Leukemia, acute promyelocytic, PML/RARA type (3) | NaN | TSG, fusion | NaN | NaN | NaN | TF cofactors | PML:(5,1,1,1,4,1,1,1,1,1,4,1,3,1,5,5,5,4,5,4,2,2,2,5,1,3,3,1,1,1,1,2,1,1,1,2,3,1,1,1,1,1,1,1,1,1,1,1,1,5,3,3,1,2,1,1,3,1,5,1,1,1,4,1,1,5,1,1,1,1,1,5,1,1,3,3,3,5,4,4,5,2,2,2,1,5,5,3,3,3,1,5,4,1,1,1,1,2,2,1,4,4,2,3,5,5,5,5,2,2,2,5,1,5,1,4,3,2,2,1,1,5,1,1,1,1,4,3,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,5,4,2,1,1,4,2,2,2,1,5,2,1,2,3,1,2,5,5,1,5,1,5,2,5,5,1,5,1,2,5,5,5,5,5,5,5,1,1,1,1,4,1,1,4,3,5,5,1,5,3,5,5,5,5,5,1,5,2,2,2,2,5,2,5,4,5,5,5,5) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 32 | 32 | GAGAATCAAAATCGGTGAATNGG | GAAAATGAAAATGGGTGATTGGG | 1 | 21975854 | 21975877 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 33 | 33 | GAGAATCAAAATCGGTGAATNGG | GAAAGTCAGAATAGGTGAATGGG | 18 | 8717824 | 8717847 | + | 4 | ['protein_coding'] | exon | ENSG00000168502 | MTCL1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | MTCL1:(2,1,1,1,2,1,1,1,1,1,4,1,2,1,3,2,2,2,1,1,1,1,1,1,4,2,4,1,1,1,1,4,1,1,1,4,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,3,1,2,1,2,4,1,3,1,1,1,4,1,1,1,1,1,1,1,1,4,1,1,2,3,2,3,4,4,1,1,1,1,4,1,4,4,2,3,1,2,4,1,1,1,1,3,4,4,1,1,1,2,3,3,1,1,1,1,1,1,3,4,1,2,3,3,4,1,1,3,1,1,1,1,3,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,3,4,3,3,1,1,1,1,1,1,1,1,2,1,1,4,1,1,2,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,4,3,2,1,1,3,1,2,2,4,4,3,4,1,1,1,1,1,1,1,3,3,2,4,4,4) | [] | NaN | [''] | [''] | [''] | ENSG00000206418 | [''] | [''] | [''] | Medium_coding |
| 34 | 34 | GAGAATCAAAATCGGTGAATNGG | GAAATCCAAAATTGGTGAATTGG | 3 | 138570394 | 138570417 | - | 4 | ['protein_coding'] | exon | ENSG00000114107 | CEP70 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | CEP70:(2,1,1,1,4,1,1,1,1,1,4,1,4,1,4,3,4,4,1,1,1,1,1,1,4,4,5,1,1,1,1,5,1,1,1,4,4,1,1,1,1,1,1,1,1,1,1,1,1,3,4,5,1,2,1,4,4,1,4,1,1,1,4,1,1,4,1,1,1,1,1,4,1,1,4,4,2,4,4,4,1,1,1,1,4,1,4,4,3,4,1,4,5,1,1,1,1,2,2,1,4,4,4,4,4,3,1,1,1,1,1,1,4,4,1,3,5,4,4,1,4,1,5,2,5,4,1,4,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,3,4,5,1,1,4,2,4,4,1,4,2,1,4,1,1,4,4,4,1,2,1,4,3,4,4,4,4,1,2,4,1,4,4,4,1,2,1,1,1,1,5,1,1,4,4,2,2,4,1,1,2,3,4,5,4,1,2,2,2,2,2,4,4,4,4,4,5,4,4) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Medium_coding |
| 35 | 35 | GAGAATCAAAATCGGTGAATNGG | GAAATTAAAAATCAGTGAATAGG | 14 | 52741736 | 52741759 | - | 4 | ['protein_coding'] | transcript | ENSG00000198252 | STYX | NaN | NaN | NaN | NaN | NaN | NaN | NaN | STYX:(2,1,1,1,4,1,1,1,1,1,2,1,2,1,4,2,4,3,1,1,1,1,1,1,4,2,4,1,1,1,1,2,1,1,1,4,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,3,1,3,1,3,2,1,2,1,1,1,3,1,1,2,1,1,1,1,1,3,1,1,2,2,2,2,3,3,1,1,1,1,3,1,4,4,2,3,1,2,4,1,1,1,1,2,2,2,1,1,1,4,2,2,1,1,1,1,1,1,4,3,4,2,3,1,2,1,1,1,1,1,1,1,2,3,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,4,3,4,2,1,1,1,1,1,1,1,1,2,1,1,3,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,3,1,1,2,1,1,2,1,1,1,2,3,2,3,4,3,1,1,1,1,1,1,1,4,4,4,2,3,3) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 36 | 36 | GAGAATCAAAATCGGTGAATNGG | GAAATTCGAAAACGGTGAATGGG | 6 | 163822092 | 163822115 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 37 | 37 | GAGAATCAAAATCGGTGAATNGG | GAAGAACAAAATCGGTGTATGGG | 8 | 29134612 | 29134635 | + | 4 | ['protein_coding'] | transcript | ENSG00000197892,ENSG00000254129 | KIF13B,ENSG00000254129 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | KIF13B:(2,1,1,1,2,1,1,1,1,1,4,1,2,1,2,2,4,2,1,1,1,1,1,1,4,2,3,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,1,2,1,2,4,1,2,1,1,1,4,1,1,1,1,1,1,1,1,2,1,1,2,4,2,4,4,3,1,1,1,1,3,1,4,2,2,3,2,2,1,4,2,3,5,2,2,2,1,1,1,2,2,2,1,1,1,1,1,1,2,2,1,2,2,2,5,1,1,2,1,1,1,1,2,2,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,3,4,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,3,1,1,2,1,1,1,1,2,2,2,2,4,4,2,1,2,2,2,2,2,2,3,4,2,2,3,4,4) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 38 | 38 | GAGAATCAAAATCGGTGAATNGG | GAGAAAAAAAATCAGGGAATCGG | 5 | 133478181 | 133478204 | - | 4 | ['protein_coding'] | transcript | ENSG00000053108 | FSTL4 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | FSTL4:(1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 39 | 39 | GAGAATCAAAATCGGTGAATNGG | GAGAAAAAAAATCAGTGAATTGG | 2 | 38211467 | 38211490 | + | 3 | ['lncRNA'] | transcript | ENSG00000232973,ENSG00000227292 | CYP1B1-AS1,ENSG00000227292 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 40 | 40 | GAGAATCAAAATCGGTGAATNGG | GAGAAACAAAATCGGAGCTTTGG | 14 | 54796468 | 54796491 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 41 | 41 | GAGAATCAAAATCGGTGAATNGG | GAGAAACAAAATGGGAAAATTGG | 2 | 215453094 | 215453117 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 42 | 42 | GAGAATCAAAATCGGTGAATNGG | GAGAAACAAAATGGGTGGTTTGG | 4 | 61281927 | 61281950 | - | 4 | ['protein_coding'] | transcript | ENSG00000150471 | ADGRL3 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ADGRL3:(3,1,1,1,4,1,1,1,1,1,4,1,4,1,4,3,4,4,1,1,1,1,1,1,4,3,4,1,1,1,1,4,1,1,1,4,4,1,1,1,1,1,1,1,1,1,1,1,1,3,3,4,1,3,1,4,4,1,3,1,1,1,4,1,1,3,1,1,1,1,1,5,1,1,2,4,2,3,4,4,1,1,1,1,5,1,5,4,3,4,1,3,4,1,1,1,1,4,4,3,1,1,1,5,4,4,1,1,1,1,1,1,5,5,3,3,4,4,4,1,1,5,1,1,1,1,4,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,4,3,3,3,1,1,1,1,1,1,1,1,3,1,1,3,1,1,4,1,1,1,1,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,3,1,4,4,1,4,3,3,3,5,5,4,4,1,1,1,1,1,1,1,4,3,4,4,5,4) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 43 | 43 | GAGAATCAAAATCGGTGAATNGG | GAGAAACAAAGTCTGTGAACTGG | 3 | 108362304 | 108362327 | - | 4 | ['protein_coding'] | transcript | ENSG00000114455 | HHLA2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | HHLA2:(2,1,1,1,2,1,1,1,1,1,4,1,2,1,2,2,2,2,1,1,1,1,1,1,2,1,1,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,1,2,1,2,2,1,2,1,1,1,5,1,1,2,1,1,1,1,1,4,1,1,2,2,2,2,2,2,1,1,1,1,2,1,5,2,2,2,1,2,2,1,1,1,1,2,2,2,1,1,1,2,2,2,1,1,1,1,1,1,1,2,2,2,2,2,2,1,1,2,1,1,1,1,2,2,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,5,1,1,2,2,2,2,1,2,2,2,2,5,2,2,2,1,1,1,1,1,1,1,2,2,2,2,2,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 44 | 44 | GAGAATCAAAATCGGTGAATNGG | GAGAAACAGAATAAGTGAATAGG | X | 117787022 | 117787045 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 45 | 45 | GAGAATCAAAATCGGTGAATNGG | GAGAAACAGAATAGGTGTATGGG | 8 | 35450773 | 35450796 | - | 4 | ['protein_coding'] | transcript | ENSG00000156687 | UNC5D | NaN | NaN | NaN | NaN | NaN | NaN | NaN | UNC5D:(1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 46 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | ['lncRNA'] | exon | ENSG00000276107,ENSG00000137801 | THBS1-IT1,THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | THBS1:(2,1,1,1,4,1,1,1,1,1,4,1,4,1,4,2,3,5,3,2,2,4,2,2,1,2,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,4,2,2,1,2,1,4,3,1,4,1,1,1,5,1,1,3,1,1,1,1,1,5,1,1,4,3,3,3,5,3,3,2,5,2,1,3,5,5,2,2,1,4,4,1,1,1,1,2,2,3,1,1,1,4,5,5,1,1,1,1,1,1,1,3,1,3,5,4,3,1,1,1,1,1,1,1,4,2,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,3,5,3,2,1,1,1,1,1,1,1,1,3,1,1,4,1,1,2,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,5,1,3,3,1,2,1,5,4,5,5,4,1,4,2,2,2,2,4,2,3,4,4,3,4,3) | [] | NaN | [''] | [''] | [''] | ENSG00000128944 | [''] | [''] | ['oncogene'] | Medium_regulatory |
| 47 | 47 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCTTTGAATTGG | 12 | 89861523 | 89861546 | + | 4 | ['lncRNA'] | transcript | ENSG00000258216 | ENSG00000258216 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 48 | 48 | GAGAATCAAAATCGGTGAATNGG | GAGAAATAGAATCAGTGAATGGG | 11 | 78406995 | 78407018 | + | 4 | ['protein_coding'] | transcript | ENSG00000033327,ENSG00000254420 | GAB2,ENSG00000254420 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | GAB2:(4,1,1,1,4,1,1,1,1,1,4,1,3,1,4,2,4,4,1,1,1,1,1,1,4,4,3,1,1,1,1,4,1,1,1,4,4,1,1,1,1,1,1,1,1,1,1,1,1,3,4,3,1,4,1,4,3,1,4,1,1,1,4,1,1,4,1,1,1,1,1,4,1,1,4,4,4,4,4,4,1,1,1,1,4,1,4,4,4,4,1,4,4,1,1,1,1,3,4,3,1,1,1,4,3,4,1,1,1,1,1,1,4,4,4,4,4,3,4,1,1,3,1,1,1,1,4,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,4,4,4,4,1,1,1,1,1,1,1,1,4,1,1,4,1,1,4,1,1,1,1,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,4,1,5,1,1,5,1,4,4,4,4,4,4,1,1,1,1,1,1,1,4,4,4,4,4,4) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 49 | 49 | GAGAATCAAAATCGGTGAATNGG | GAGAACCAAAATCAATGAGTAGG | 10 | 116159111 | 116159134 | + | 4 | ['protein_coding'] | transcript | ENSG00000151892 | GFRA1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | GFRA1:(2,1,1,1,2,1,1,1,1,1,5,1,2,1,3,2,3,2,1,1,1,1,1,1,2,2,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,1,2,1,2,2,1,3,1,1,1,4,1,1,3,1,1,1,1,1,5,1,1,2,4,2,4,2,2,1,1,1,1,2,1,4,4,2,2,1,3,4,1,1,1,1,2,4,2,1,1,1,2,2,2,1,1,1,1,1,1,2,2,2,2,2,3,3,1,1,4,1,1,1,1,2,4,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,2,2,4,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,4,1,2,2,1,2,2,2,2,3,2,2,4,1,1,1,1,1,1,1,2,4,2,2,2,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 50 | 50 | GAGAATCAAAATCGGTGAATNGG | GAGAACCAAAATTAGTAAATGGG | 13 | 50092090 | 50092113 | + | 4 | ['lncRNA'] | transcript | ENSG00000176124,ENSG00000231607 | DLEU1,DLEU2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 51 | 51 | GAGAATCAAAATCGGTGAATNGG | GAGAACTAAAATAGGTTAATGGG | 21 | 5997295 | 5997318 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 52 | 52 | GAGAATCAAAATCGGTGAATNGG | GAGAACTAAAATAGGTTAATGGG | 21 | 43541253 | 43541276 | - | 4 | ['protein_coding'] | transcript | ENSG00000160207 | HSF2BP | NaN | NaN | NaN | NaN | NaN | NaN | NaN | HSF2BP:(2,1,1,1,2,1,1,1,1,1,2,1,2,1,2,2,2,2,1,1,1,1,1,1,2,2,3,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,4,1,2,1,2,2,1,2,1,1,1,2,1,1,2,1,1,1,1,1,2,1,1,2,2,2,2,2,2,1,1,1,1,2,1,2,2,2,3,1,2,2,1,1,1,1,2,2,2,1,1,1,2,2,2,1,1,1,1,1,1,2,2,1,2,2,2,2,1,5,3,2,2,3,3,1,2,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,2,1,2,1,2,2,2,2,2,2,2,2,1,2,3,2,3,2,2,2,2,2,2,2,2,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 53 | 53 | GAGAATCAAAATCGGTGAATNGG | GAGAAGAAAAATCAGTGAATTGG | 20 | 21476782 | 21476805 | + | 3 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 54 | 54 | GAGAATCAAAATCGGTGAATNGG | GAGAAGAAAAATGGGTGAACGGG | 12 | 129565058 | 129565081 | + | 4 | ['protein_coding'] | transcript | ENSG00000151952 | TMEM132D | NaN | NaN | NaN | NaN | NaN | NaN | NaN | TMEM132D:(2,1,1,1,2,1,1,1,1,1,2,1,2,1,2,2,2,2,1,1,1,1,1,1,2,2,2,1,1,1,1,3,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,1,2,1,2,2,1,2,1,1,1,2,1,1,2,1,1,1,1,1,2,1,1,2,2,2,2,2,2,1,1,1,1,2,1,2,2,2,2,1,2,2,1,1,1,1,2,2,2,1,1,1,2,2,2,1,1,1,1,1,1,2,2,1,2,2,2,2,1,1,2,1,1,1,1,2,2,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,2,1,2,2,1,2,2,2,2,2,2,3,3,1,1,1,1,1,1,1,2,2,2,2,2,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 55 | 55 | GAGAATCAAAATCGGTGAATNGG | GAGAAGCAAAATCGGTGTGATGG | 2 | 207225277 | 207225300 | - | 4 | ['lncRNA'] | transcript | ENSG00000234902,ENSG00000229647 | ENSG00000234902,MYOSLID | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 56 | 56 | GAGAATCAAAATCGGTGAATNGG | GAGAAGCAAAATGGGTGCAAAGG | 18 | 51495041 | 51495064 | + | 4 | ['lncRNA'] | transcript | ENSG00000227115 | LINC01630 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 57 | 57 | GAGAATCAAAATCGGTGAATNGG | GAGAAGCAAGATGGGTTAATAGG | 3 | 133628781 | 133628804 | + | 4 | ['protein_coding'] | transcript | ENSG00000163781 | TOPBP1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | TOPBP1:(5,1,1,1,5,1,1,1,1,1,5,1,1,1,5,5,5,5,1,1,1,1,1,1,5,5,5,1,1,1,1,5,1,1,1,5,5,1,1,1,1,1,1,1,1,1,1,1,1,5,5,5,1,3,1,5,5,1,5,1,1,1,5,1,1,5,1,1,1,1,1,5,1,1,5,5,5,5,5,5,1,1,1,1,5,1,5,5,5,5,1,5,5,1,1,1,1,4,4,5,1,1,1,5,5,5,1,1,1,1,1,1,5,5,5,4,5,4,4,1,1,1,1,1,1,1,5,5,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,5,5,5,5,1,1,1,1,1,1,1,1,5,1,1,5,1,1,5,1,1,1,1,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,1,5,1,1,5,1,5,1,5,5,5,5,5,5,5,4,5,1,1,1,1,1,1,1,5,5,5,5,5,5) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 58 | 58 | GAGAATCAAAATCGGTGAATNGG | GAGAAGCAGAATGGGTGTATGGG | 10 | 17805893 | 17805916 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 59 | 59 | GAGAATCAAAATCGGTGAATNGG | GAGAAGCTACATAGGTGAATGGG | 2 | 162891805 | 162891828 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 60 | 60 | GAGAATCAAAATCGGTGAATNGG | GAGAATAAAAATCGGGGAGCAGG | 3 | 29620001 | 29620024 | + | 4 | ['protein_coding'] | transcript | ENSG00000144642,ENSG00000283563,ENSG00000203506 | RBMS3,RBMS3-AS2,ENSG00000283563 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | RBMS3:(4,1,1,1,2,1,1,1,1,1,2,1,2,1,3,3,5,4,1,1,1,1,1,1,4,3,5,1,1,1,1,5,1,1,1,4,3,1,1,1,1,1,1,1,1,1,1,1,1,4,3,5,1,3,1,2,2,1,4,1,1,1,2,1,1,5,1,1,1,1,1,3,1,1,2,2,3,2,4,2,1,1,1,1,4,1,4,4,3,4,1,5,5,1,1,1,1,4,2,3,1,1,1,4,3,3,1,1,1,1,1,1,4,2,1,4,3,2,3,1,1,1,1,1,1,1,4,4,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,5,5,5,2,1,1,1,1,1,1,1,1,4,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,2,4,4,4,4,4,1,3,2,2,2,4,2,1,1,1,1,1,1,1,4,2,3,2,4,2) | ['ENSG00000144642'] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 61 | 61 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAAACAGCAGAATAGG | 1 | 19967519 | 19967542 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 62 | 62 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAAACCTGAGACTGGG | 4 | 133351447 | 133351470 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 63 | 63 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAAAGACGTGAAGAGG | 22 | 41470840 | 41470863 | - | 4 | ['protein_coding'] | transcript | ENSG00000100412 | ACO2 | Infantile cerebellar-retinal degeneration, 614559 (3), ; ?Optic atrophy 9, 616289 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | ACO2:(2,1,1,1,5,1,1,1,1,1,5,1,4,1,5,2,5,5,1,1,1,1,1,1,1,5,5,5,2,5,2,1,5,2,2,1,1,5,2,3,5,2,2,2,2,2,5,5,2,3,5,5,1,4,1,5,1,1,3,1,1,1,5,1,1,5,1,1,1,1,1,5,1,1,5,5,4,5,5,5,1,1,1,1,5,1,5,5,5,5,5,5,1,5,5,5,2,5,3,1,4,5,4,5,4,5,1,1,1,1,1,1,5,5,5,4,5,4,5,1,5,3,3,5,5,4,1,5,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,5,5,4,1,1,5,2,5,5,1,5,2,1,2,1,1,5,5,5,1,5,2,5,2,5,5,1,5,1,2,4,1,5,5,5,1,5,1,1,1,1,5,1,1,4,1,1,1,1,2,4,5,5,5,4,5,1,2,5,2,2,2,5,5,5,1,5,5,5,5) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 64 | 64 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAAATCGGTGAATAGG | 14 | 22547572 | 22547595 | - | 0 | ['TR_C_gene'] | exon | ENSG00000277734 | TRAC | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 65 | 65 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAAATCTTATAATGGG | 1 | 60145105 | 60145128 | - | 4 | ['lncRNA'] | transcript | ENSG00000238242 | LINC02778 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 66 | 66 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAAATGAGTTATTTGG | 1 | 215241122 | 215241145 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 67 | 67 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAAATTGTTAAAGTGG | 7 | 121721147 | 121721170 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 68 | 68 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAAATTTCTGAAGAGG | X | 68155622 | 68155645 | - | 4 | ['protein_coding'] | transcript | ENSG00000079482 | OPHN1 | Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486 (3) | X-linked recessive | NaN | NaN | NaN | NaN | NaN | OPHN1:(3,1,1,1,3,1,1,1,1,1,4,1,4,1,4,2,4,3,1,1,1,1,1,1,4,2,3,1,1,1,1,4,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,4,1,2,1,4,1,1,3,1,1,1,4,1,1,4,1,1,1,1,1,4,1,1,2,4,2,4,4,4,1,1,1,1,4,1,3,3,2,3,1,4,2,1,1,1,1,3,3,4,1,1,1,4,4,2,1,1,1,1,1,1,1,4,3,3,3,3,1,1,1,2,1,1,1,1,4,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,4,3,3,2,1,1,1,1,1,1,1,1,3,1,1,4,1,1,2,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,3,1,3,4,1,3,3,4,3,4,4,3,1,2,2,2,2,5,2,2,4,3,2,4,4,4) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 69 | 69 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAACCAGGTGAAGGGG | 7 | 81767131 | 81767154 | - | 4 | ['protein_coding'] | transcript | ENSG00000019991 | HGF | Deafness, autosomal recessive 39, 608265 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | HGF:(3,1,1,1,4,1,1,1,1,1,4,1,3,1,3,2,4,3,1,1,1,1,1,1,4,4,4,1,1,1,1,4,1,1,1,4,4,1,1,1,1,1,1,1,1,1,1,1,1,2,4,4,1,3,1,4,3,1,2,1,1,1,4,1,1,4,1,1,1,1,1,4,1,1,4,4,4,4,4,4,1,1,1,1,4,1,4,3,3,4,1,4,4,1,1,1,1,4,3,3,1,1,1,4,2,3,1,1,1,1,1,1,4,4,1,4,4,4,4,1,1,1,1,1,1,1,4,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,4,4,2,4,1,1,1,1,1,1,1,1,4,1,1,4,1,1,2,1,1,1,1,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,3,1,2,3,2,2,3,3,2,4,4,4,4,1,1,1,1,1,1,1,4,4,4,4,4,3) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 70 | 70 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAATATCACTGAAATGG | 16 | 80999456 | 80999479 | + | 4 | ['protein_coding'] | transcript | ENSG00000103121,ENSG00000286221 | ENSG00000286221,CMC2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | CMC2:(2,1,1,1,4,1,1,1,1,1,4,1,3,1,2,2,3,3,1,1,1,1,1,1,4,3,2,1,1,1,1,3,1,1,1,3,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,4,1,2,1,3,3,1,3,1,1,1,4,1,1,3,1,1,1,1,1,4,1,1,2,4,2,4,4,4,1,1,1,1,4,1,4,4,3,2,1,2,4,1,1,1,1,3,4,3,1,1,1,4,4,4,1,1,1,1,1,1,2,3,2,2,3,3,4,1,1,4,1,1,1,1,4,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,3,4,4,2,1,1,1,1,1,1,1,1,2,1,1,3,1,1,2,1,1,1,1,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,3,2,2,2,2,2,2,2,2,4,4,4,5,1,1,1,1,1,1,1,3,4,4,4,4,3) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 71 | 71 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAATATCGTTAAAATGG | 12 | 33913627 | 33913650 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 72 | 72 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAATATCGTTAAAATGG | 1 | 46972533 | 46972556 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 73 | 73 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAATATGGGGGAAGTGG | 7 | 34521147 | 34521170 | + | 4 | ['lncRNA'] | transcript | ENSG00000197085 | NPSR1-AS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 74 | 74 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAATATTGGTAAAATGG | 3 | 34588687 | 34588710 | - | 4 | ['lncRNA'] | transcript | ENSG00000226320 | LINC01811 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 75 | 75 | GAGAATCAAAATCGGTGAATNGG | GAGAATCACAATCGGTCCACTGG | 1 | 182382367 | 182382390 | + | 4 | ['protein_coding'] | exon | ENSG00000135821 | GLUL | Glutamine deficiency, congenital, 610015 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | GLUL:(5,1,1,1,2,1,1,1,1,1,2,1,2,1,3,2,3,2,2,3,2,2,2,2,1,5,3,1,1,1,1,3,1,1,1,4,4,1,1,1,1,1,1,1,1,1,1,1,1,4,5,4,1,5,1,2,3,1,3,1,1,1,4,1,1,2,1,1,1,1,1,3,1,1,2,2,2,2,5,3,3,2,2,2,1,2,3,2,5,3,1,2,2,1,1,1,1,2,4,2,1,1,1,3,2,2,2,3,2,2,2,2,1,3,2,3,2,3,2,1,1,2,1,1,1,1,5,2,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,3,4,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,3,1,1,2,1,2,2,1,2,2,2,2,4,4,5,4,1,1,1,1,1,1,1,4,2,2,3,5,3) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | High_coding |
| 76 | 76 | GAGAATCAAAATCGGTGAATNGG | GAGAATCATAATCAATGAACTGG | 10 | 60975179 | 60975202 | + | 4 | ['protein_coding'] | transcript | ENSG00000072422 | RHOBTB1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | RHOBTB1:(4,1,1,1,5,1,1,1,1,1,5,1,4,1,5,4,5,5,1,1,1,1,1,1,5,5,4,1,1,1,1,5,1,1,1,4,3,1,1,1,1,1,1,1,1,1,1,1,1,4,4,4,1,4,1,5,4,1,4,1,1,1,5,1,1,1,1,1,1,1,1,5,1,1,4,5,3,4,4,4,1,1,1,1,5,1,5,4,5,5,1,5,5,1,1,1,1,4,4,4,1,1,1,4,4,4,1,1,1,1,1,1,1,4,1,5,5,5,5,1,1,1,1,1,1,1,5,4,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,4,4,4,5,1,1,1,1,1,1,1,1,5,1,1,5,1,1,5,1,1,1,1,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,1,5,1,1,4,1,5,4,4,5,1,2,3,5,5,5,5,1,1,1,1,1,1,1,5,4,4,5,4,4) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 77 | 77 | GAGAATCAAAATCGGTGAATNGG | GAGAATCCAAATCAGTAAAGGGG | 7 | 109776998 | 109777021 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 78 | 78 | GAGAATCAAAATCGGTGAATNGG | GAGAATCCAAATTGGTAAAGAGG | 3 | 102367220 | 102367243 | - | 4 | ['protein_coding'] | transcript | ENSG00000170044 | ZPLD1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 79 | 79 | GAGAATCAAAATCGGTGAATNGG | GAGAATCTAATTCATTGAATTGG | 3 | 26863382 | 26863405 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 80 | 80 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAACGAGGAATTGG | 2 | 63889184 | 63889207 | + | 4 | ['protein_coding'] | transcript | ENSG00000169764 | UGP2 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | UGP2:(3,1,1,1,3,1,2,3,2,1,1,2,1,2,2,2,2,2,1,1,1,1,1,1,3,2,2,2,3,2,2,1,2,2,2,1,1,2,2,2,2,2,2,2,1,2,2,1,1,2,2,2,1,2,1,2,2,2,2,2,2,2,1,2,2,2,2,2,1,2,2,1,2,2,2,2,2,2,2,2,1,1,1,1,2,1,2,4,2,2,1,2,3,1,1,1,1,2,5,2,1,1,1,2,2,2,1,1,1,1,1,1,3,2,2,2,2,2,2,1,1,3,1,1,1,1,3,2,2,1,3,2,2,1,2,2,1,1,1,1,1,1,1,1,1,2,2,4,1,1,2,2,2,2,1,2,2,1,2,1,1,2,2,2,1,2,1,2,2,2,2,1,2,1,2,3,1,2,2,2,4,2,2,2,1,2,1,2,2,2,2,2,2,2,2,2,2,2,2,2,4,1,4,2,2,2,3,4,3,2,2,2,2,2,2) | [] | NaN | [''] | [''] | [''] | ENSG00000197329 | [''] | [''] | [''] | Low_coding |
| 81 | 81 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAACCAGTGCATCGG | 8 | 6807804 | 6807827 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 82 | 82 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAGAGATGAATAGG | 10 | 79560000 | 79560023 | + | 4 | ['protein_coding'] | exon | ENSG00000185303 | SFTPA2 | Pulmonary fibrosis, idiopathic, 178500 (3) | Autosomal dominant | NaN | NaN | NaN | NaN | NaN | SFTPA2:(2,1,1,1,2,1,1,1,1,1,2,1,2,1,2,2,2,2,1,1,1,1,1,1,2,2,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,1,2,1,2,2,1,2,1,1,1,2,1,1,2,1,1,1,1,1,2,1,1,2,2,2,2,2,2,1,1,1,1,2,1,2,2,2,2,1,2,2,1,1,1,1,2,2,1,5,5,2,5,2,2,1,1,1,1,1,1,2,2,2,2,2,2,2,1,1,2,1,1,1,1,2,2,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,2,1,2,2,1,2,2,2,2,2,2,2,2,1,1,1,1,1,1,1,2,2,2,2,2,2) | [] | ENSG00000185303 | ['Pulmonary fibrosis, idiopathic, 178500 (3)'] | ['Autosomal dominant'] | [''] | NaN | [''] | [''] | [''] | High_coding |
| 83 | 83 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAATAGATGATTGGG | 7 | 34029247 | 34029270 | + | 4 | ['protein_coding'] | transcript | ENSG00000164619 | BMPER | Diaphanospondylodysostosis, 608022 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 84 | 84 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAATGGTTGAAACGG | 20 | 61122747 | 61122770 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 85 | 85 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAATGAGGTGAATTGG | 5 | 118142872 | 118142895 | - | 4 | ['lncRNA'] | transcript | ENSG00000250891,ENSG00000249797 | LINC02147,LINC02208 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 86 | 86 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAATATTGGGGAATTGG | 1 | 236265989 | 236266012 | - | 4 | ['protein_coding'] | transcript | ENSG00000086619 | ERO1B | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ERO1B:(3,1,1,1,4,1,1,1,1,1,4,1,2,1,3,2,4,4,1,1,1,1,1,1,4,3,4,1,1,1,1,4,1,1,1,3,2,1,1,1,1,1,1,1,1,1,1,1,1,4,2,3,1,4,1,4,2,1,3,1,1,1,4,1,1,1,1,1,1,1,1,4,1,1,3,4,3,2,5,4,1,1,1,1,4,1,4,3,3,3,1,3,4,1,1,1,1,3,4,3,1,1,1,3,3,4,1,1,1,1,1,1,4,3,1,3,5,1,3,1,1,3,1,1,1,1,3,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,3,4,3,2,1,1,1,1,1,1,1,1,2,1,1,3,1,1,2,1,1,1,1,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,3,2,3,2,1,2,3,3,2,5,5,3,5,1,1,1,1,1,1,1,4,3,3,3,3,3) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 87 | 87 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAATGTGGGTGAATGGG | 8 | 19464151 | 19464174 | - | 4 | ['protein_coding'] | transcript | ENSG00000147408 | CSGALNACT1 | Skeletal dysplasia, mild, with joint laxity and advanced bone age, 618870 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 88 | 88 | GAGAATCAAAATCGGTGAATNGG | GAGAATGTAAATCTGTGAGTAGG | 6 | 94593684 | 94593707 | - | 4 | ['lncRNA'] | transcript | ENSG00000289178 | ENSG00000289178 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 89 | 89 | GAGAATCAAAATCGGTGAATNGG | GAGAATTAAAATCAGCCAATGGG | 1 | 168633592 | 168633615 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 90 | 90 | GAGAATCAAAATCGGTGAATNGG | GAGAATTAAAATCGGTGCGAAGG | 16 | 22563467 | 22563490 | - | 4 | ['transcribed_unprocessed_pseudogene', 'lncRNA'] | transcript | ENSG00000290866,ENSG00000257838 | OTOAP1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 91 | 91 | GAGAATCAAAATCGGTGAATNGG | GAGAATTAAAATCGGTGCGAAGG | 16 | 21747344 | 21747367 | - | 4 | ['protein_coding'] | transcript | ENSG00000155719 | OTOA | Deafness, autosomal recessive 22, 607039 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | OTOA:(2,1,1,1,2,1,1,1,1,1,2,1,2,1,2,2,2,2,1,1,1,1,1,1,2,2,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,1,2,1,2,2,1,2,1,1,1,2,1,1,2,1,1,1,1,1,2,1,1,2,2,2,2,2,2,1,1,1,1,2,1,2,2,2,2,1,2,2,1,1,1,1,2,2,2,1,1,1,2,2,2,1,1,1,1,1,1,2,2,2,2,2,2,2,1,1,1,1,1,1,1,2,2,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,2,2,2,2,2,2,2,4,2,2,2,2,2,1,1,1,1,1,1,1,2,2,2,2,2,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 92 | 92 | GAGAATCAAAATCGGTGAATNGG | GAGAATTACAATCAATGAATGGG | 11 | 62125897 | 62125920 | + | 4 | ['protein_coding'] | transcript | ENSG00000149503 | INCENP | NaN | NaN | NaN | NaN | NaN | NaN | NaN | INCENP:(2,1,1,1,3,1,5,4,2,4,1,4,1,4,4,2,4,2,1,1,1,1,1,1,2,3,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,1,2,1,2,4,5,2,4,2,2,1,4,4,2,5,4,1,2,1,1,4,1,2,4,4,2,2,4,1,1,1,1,2,1,2,3,3,2,1,2,2,1,1,1,1,2,2,2,1,1,1,2,5,4,1,1,1,1,1,1,2,4,1,2,2,2,2,1,4,2,2,2,2,2,1,2,5,2,4,2,2,1,4,4,2,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,3,1,1,2,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,1,1,1,5,4,1,2,1,4,2,2,2,2,2,2,2,2,4,3,2,3,3,1,2,4,2,4,2,2,2,2,5,4,4,4,4) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 93 | 93 | GAGAATCAAAATCGGTGAATNGG | GAGACACAAAATCAGTGAAGGGG | 8 | 24218172 | 24218195 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 94 | 94 | GAGAATCAAAATCGGTGAATNGG | GAGACTCAAAAGTCGTGAATGGG | 10 | 67626654 | 67626677 | + | 4 | ['protein_coding'] | transcript | ENSG00000183230 | CTNNA3 | Arrhythmogenic right ventricular dysplasia, familial, 13, 615616 (3) | Autosomal dominant | NaN | NaN | NaN | NaN | NaN | CTNNA3:(2,1,1,1,2,1,1,1,1,1,2,1,2,1,2,2,2,2,1,1,1,1,1,1,2,2,2,4,2,2,2,1,2,2,2,1,1,2,2,3,2,2,2,2,2,2,2,4,2,2,2,2,1,2,1,2,2,1,2,1,1,1,2,1,1,2,1,1,1,1,1,3,1,1,2,2,2,2,2,2,1,1,1,1,3,1,3,4,3,2,1,2,2,1,1,1,1,2,2,2,1,1,1,2,2,2,1,1,1,1,1,1,2,2,2,2,2,2,2,1,1,2,1,1,1,1,2,2,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,2,1,2,1,1,2,1,2,2,2,2,2,2,1,1,1,1,1,1,1,2,2,2,2,3,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 95 | 95 | GAGAATCAAAATCGGTGAATNGG | GAGACTCTAGATCTGTGAATAGG | 16 | 30600288 | 30600311 | + | 4 | ['lncRNA'] | transcript | ENSG00000260167 | ENSG00000260167 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 96 | 96 | GAGAATCAAAATCGGTGAATNGG | GAGACTGAGAATGGGTGAATGGG | 2 | 121007545 | 121007568 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 97 | 97 | GAGAATCAAAATCGGTGAATNGG | GAGAGCGAAAATCAGTGAATCGG | 13_KI270838v1_alt | 292105 | 292128 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 98 | 98 | GAGAATCAAAATCGGTGAATNGG | GAGAGCGAAAATCAGTGAATCGG | 13 | 112491135 | 112491158 | - | 4 | ['protein_coding'] | transcript | ENSG00000126216 | TUBGCP3 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | TUBGCP3:(3,1,1,1,5,1,1,1,1,1,4,1,5,1,5,1,1,1,1,1,1,1,1,1,5,3,2,1,1,1,1,3,1,1,1,4,2,1,1,1,1,1,1,1,1,1,1,1,1,3,2,3,1,4,1,4,5,1,3,1,1,1,5,1,1,2,1,1,1,1,1,5,1,1,2,3,3,5,4,5,1,1,1,1,4,1,5,4,3,2,1,3,5,1,1,1,1,4,5,3,1,1,1,2,5,5,1,1,1,1,1,1,5,5,1,3,5,1,4,1,1,1,1,1,1,1,5,4,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,5,5,4,3,1,1,1,1,1,1,1,1,4,1,1,4,1,1,4,1,1,1,1,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,1,5,1,1,4,1,1,1,4,1,1,3,5,4,5,4,1,4,2,2,3,2,2,3,4,1,5,5,5,5) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 99 | 99 | GAGAATCAAAATCGGTGAATNGG | GAGAGTCAAAAAGGGGGAATGGG | 8 | 33276809 | 33276832 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 100 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | ['protein_coding'] | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | GMFG:(3,1,1,1,4,1,1,1,1,1,4,1,4,1,3,2,4,3,1,1,1,1,1,1,3,2,4,1,1,1,1,4,1,1,1,3,3,1,1,1,1,1,1,1,1,1,1,1,1,3,2,4,1,4,1,4,2,1,3,1,1,1,3,1,1,4,1,1,1,1,1,4,1,1,2,4,3,4,4,2,1,1,1,1,3,1,4,2,2,4,1,4,4,1,1,1,1,2,3,4,1,1,1,4,3,2,1,1,1,1,1,1,4,2,1,3,4,4,4,1,1,3,1,1,1,1,4,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,3,4,2,4,1,1,1,1,1,1,1,1,4,1,1,4,1,1,4,1,1,1,1,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,2,1,4,4,1,4,4,2,2,4,4,4,3,1,1,1,1,1,1,1,4,1,2,4,4,2) | [] | NaN | [''] | [''] | [''] | ENSG00000128626 | [''] | [''] | [''] | Low_coding |
| 101 | 101 | GAGAATCAAAATCGGTGAATNGG | GAGATTCTAAATCTGTGTATTGG | 3 | 25948324 | 25948347 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 102 | 102 | GAGAATCAAAATCGGTGAATNGG | GAGATTTAAAATCAGGGAATTGG | 16 | 31212022 | 31212045 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 103 | 103 | GAGAATCAAAATCGGTGAATNGG | GAGCATCAAAATCGGTAAAGAGG | X | 152319010 | 152319033 | + | 3 | ['protein_coding'] | transcript | ENSG00000011677 | GABRA3 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | GABRA3:(2,1,1,1,2,1,1,1,1,1,2,1,2,1,2,2,2,2,1,1,1,1,1,1,2,2,2,2,2,2,2,1,2,2,2,1,1,2,2,2,2,2,2,2,1,2,3,1,1,2,2,2,1,3,1,2,2,1,2,1,1,1,2,1,1,2,1,1,1,1,1,2,1,1,2,2,2,2,2,2,1,1,1,1,2,1,2,2,2,3,1,2,2,1,1,1,1,2,2,2,1,1,1,2,2,2,1,1,1,1,1,1,2,2,2,2,2,2,2,1,1,2,1,1,1,1,2,2,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,2,2,2,2,1,2,2,2,2,2,2,2,2,1,1,1,1,1,1,1,2,2,2,2,2,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 104 | 104 | GAGAATCAAAATCGGTGAATNGG | GAGCATCAGAAATGGTGAATAGG | 7 | 21313185 | 21313208 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 105 | 105 | GAGAATCAAAATCGGTGAATNGG | GAGCATCCAAATCAGTAAATAGG | 4 | 165639738 | 165639761 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 106 | 106 | GAGAATCAAAATCGGTGAATNGG | GAGCATCCAAATCAGTGAAGAGG | 17 | 60795379 | 60795402 | - | 4 | ['protein_coding'] | transcript | ENSG00000141376 | BCAS3 | NaN | NaN | NaN | NaN | NaN | NaN | TF cofactors | BCAS3:(2,1,1,1,4,1,1,1,1,1,3,1,1,1,4,2,4,4,2,4,2,4,2,2,1,4,4,1,1,1,1,4,1,1,1,4,4,1,1,1,1,1,1,1,1,1,1,1,1,4,4,4,1,2,1,4,2,1,2,1,1,1,4,1,1,2,1,1,1,1,1,4,1,1,4,4,4,4,4,3,3,2,2,2,1,3,4,3,3,5,1,4,4,1,1,1,1,4,4,3,1,1,1,3,4,3,2,4,2,2,2,2,1,3,4,2,4,4,4,1,1,4,1,1,1,1,3,3,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,4,4,2,3,1,1,1,1,1,1,1,1,3,1,1,3,1,1,3,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,2,1,1,1,1,2,2,3,2,4,4,4,4,1,1,1,1,1,1,1,4,4,3,3,4,3) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 107 | 107 | GAGAATCAAAATCGGTGAATNGG | GAGCATCCAAATCGGTAAAGAGG | 3 | 109427129 | 109427152 | - | 4 | ['lncRNA'] | transcript | ENSG00000228980 | LINC01205 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 108 | 108 | GAGAATCAAAATCGGTGAATNGG | GAGCATCCAAATCGGTAAAGAGG | 2 | 19181429 | 19181452 | - | 4 | ['lncRNA'] | transcript | ENSG00000236204 | LINC01376 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 109 | 109 | GAGAATCAAAATCGGTGAATNGG | GAGCATCCAAATCGGTAAAGAGG | 6 | 34252505 | 34252528 | + | 4 | ['lncRNA'] | transcript | ENSG00000225339 | ENSG00000225339 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 110 | 110 | GAGAATCAAAATCGGTGAATNGG | GAGCATCCAAATCGGTAAAGAGG | 15 | 50174320 | 50174343 | + | 4 | ['protein_coding'] | transcript | ENSG00000104043 | ATP8B4 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ATP8B4:(2,1,1,1,5,1,1,1,1,1,5,1,3,1,4,2,4,5,1,1,1,1,1,1,5,3,5,1,1,1,1,4,1,1,1,4,3,1,1,1,1,1,1,1,1,1,1,1,1,4,3,4,1,4,1,4,4,1,5,1,1,1,5,1,1,1,1,1,1,1,1,5,1,1,3,5,3,4,4,4,1,1,1,1,4,1,5,3,3,4,1,4,4,1,1,1,1,3,4,4,1,1,1,5,3,3,1,1,1,1,1,1,5,4,1,2,5,4,4,1,1,1,1,1,1,1,5,5,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,5,4,3,4,1,1,1,1,1,1,1,1,4,1,1,4,1,1,3,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,1,5,1,1,5,1,4,1,4,4,4,5,4,5,5,5,3,1,1,1,1,1,1,1,4,4,4,4,4,3) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 111 | 111 | GAGAATCAAAATCGGTGAATNGG | GAGCATCCAAATCGGTAAAGAGG | 3 | 24075070 | 24075093 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 112 | 112 | GAGAATCAAAATCGGTGAATNGG | GAGCATCCAAATTGGTAAATAGG | 2 | 230261415 | 230261438 | - | 4 | ['protein_coding'] | transcript | ENSG00000079263 | SP140 | NaN | NaN | NaN | NaN | NaN | NaN | TF | SP140:(2,1,1,1,2,1,2,2,2,4,1,2,1,4,3,2,2,2,1,1,1,1,1,1,2,2,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,1,2,1,2,2,2,2,2,2,2,1,2,4,2,2,2,1,2,1,1,2,2,2,2,2,2,2,2,1,1,1,1,2,1,2,2,2,2,1,2,2,1,1,1,1,2,2,1,2,2,2,4,4,4,1,1,1,1,1,1,2,2,2,2,2,2,2,1,1,2,1,1,1,1,2,2,2,2,2,2,2,1,2,4,2,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,2,2,1,4,1,2,2,2,1,2,1,1,2,2,3,4,2,2,3,1,2,5,2,2,5,2,2,2,4,5,2,2,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 113 | 113 | GAGAATCAAAATCGGTGAATNGG | GAGGATCAAAATCTGTAAAATGG | 6 | 157392057 | 157392080 | - | 4 | ['protein_coding'] | transcript | ENSG00000175048 | ZDHHC14 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ZDHHC14:(2,1,1,1,2,1,1,1,1,1,3,1,2,1,2,1,2,5,2,2,2,2,2,2,1,5,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,5,4,2,1,4,1,2,2,1,2,1,1,1,2,1,1,2,1,1,1,1,1,3,1,1,2,4,2,2,2,3,2,2,3,2,1,2,2,2,5,2,1,2,5,1,1,1,1,2,4,2,1,1,1,2,2,2,2,2,1,1,1,2,1,2,3,2,3,2,2,1,1,2,1,1,1,1,3,4,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,2,1,2,1,1,2,2,2,2,3,3,4,1,2,2,2,2,2,3,2,3,2,2,2,4,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 114 | 114 | GAGAATCAAAATCGGTGAATNGG | GAGGCTCAAGATCAGTGAATGGG | 15 | 23851496 | 23851519 | - | 4 | ['lncRNA'] | transcript | ENSG00000286973 | ENSG00000286973 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 115 | 115 | GAGAATCAAAATCGGTGAATNGG | GAGTATGAAAATCGCTGAATAGG | 10 | 21110550 | 21110573 | - | 3 | ['protein_coding'] | transcript | ENSG00000078114 | NEBL | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NEBL:(2,1,1,1,3,1,1,1,1,1,4,1,2,1,2,2,2,2,1,1,1,1,1,1,3,2,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,1,2,1,3,2,1,2,1,1,1,4,1,1,2,1,1,1,1,1,4,1,1,2,3,2,3,3,2,1,1,1,1,3,1,4,5,2,2,1,2,3,1,1,1,1,2,4,2,1,1,1,3,2,3,1,1,1,1,1,1,3,2,2,2,4,3,3,1,1,2,1,1,1,1,2,2,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,2,2,2,2,1,2,2,3,2,4,4,2,1,2,2,2,2,2,2,5,3,3,3,2,3,2) | [] | NaN | [''] | [''] | [''] | ENSG00000231920 | [''] | [''] | [''] | Low_coding |
| 116 | 116 | GAGAATCAAAATCGGTGAATNGG | GATAATAAAAATCAGTGTATTGG | 14 | 48853799 | 48853822 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 117 | 117 | GAGAATCAAAATCGGTGAATNGG | GATAATAAAAATGAGTGAATGGG | 12 | 46121456 | 46121479 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 118 | 118 | GAGAATCAAAATCGGTGAATNGG | GATAATAATAATCGGTGTATAGG | 6 | 113854393 | 113854416 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 119 | 119 | GAGAATCAAAATCGGTGAATNGG | GATAATCAAAATCAGTCCATTGG | 4 | 114944688 | 114944711 | - | 4 | ['protein_coding'] | transcript | ENSG00000138653 | NDST4 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NDST4:(1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 120 | 120 | GAGAATCAAAATCGGTGAATNGG | GGAAATCCAAATCGGTGAAGAGG | 9 | 62840601 | 62840624 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 121 | 121 | GAGAATCAAAATCGGTGAATNGG | GGAAATCCAAATCGGTGAAGAGG | 9 | 63779440 | 63779463 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 122 | 122 | GAGAATCAAAATCGGTGAATNGG | GGAAATCGAAATCGGTGAAGAGG | 9 | 41276235 | 41276258 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 123 | 123 | GAGAATCAAAATCGGTGAATNGG | GGAAATGAAAATAGGTGAATTGG | 2 | 125967379 | 125967402 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 124 | 124 | GAGAATCAAAATCGGTGAATNGG | GGCAATCAATATCGGTGGATGGG | 16 | 71992820 | 71992843 | - | 4 | ['protein_coding'] | transcript | ENSG00000277481 | PKD1L3 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 125 | 125 | GAGAATCAAAATCGGTGAATNGG | GGGAAACAAAAGCGGGGAATTGG | 11 | 118872252 | 118872275 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | ENSG00000095139,ENSG00000256269,ENSG00000172273,ENSG00000188486,ENSG00000118181,ENSG00000110395,ENSG00000160703,ENSG00000196655,ENSG00000172375,ENSG00000172269,ENSG00000149582,ENSG00000118096 | ['Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay, 617164 (3)', 'Porphyria, acute intermittent, 176000 (3), ; Porphyria, acute intermittent, nonerythroid variant, 176000 (3)', 'Congenital disorder of glycosylation, type Ij, 608093 (3), ; Myasthenic syndrome, congenital, 13, with tubular aggregates, 614750 (3)', 'Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia, 613563 (3), ; ?Juvenile myelomonocytic leukemia, 607785 (3), Somatic mutation', 'Neurodevelopmental disorder with epilepsy, spasticity, and brain atrophy, 618741 (3)'] | ['Autosomal recessive', 'Autosomal dominant'] | ['oncogene, TSG, fusion'] | NaN |
| 126 | 126 | GAGAATCAAAATCGGTGAATNGG | GGGAAGCAGAATTGGTGAATTGG | 9 | 23172517 | 23172540 | - | 4 | ['lncRNA'] | transcript | ENSG00000284418 | ENSG00000284418 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 127 | 127 | GAGAATCAAAATCGGTGAATNGG | GGGAATCAAAATAGGAGAACGGG | 1 | 23909844 | 23909867 | - | 4 | ['protein_coding'] | transcript | ENSG00000188822 | CNR2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | CNR2:(3,1,1,1,4,1,1,1,1,1,5,1,3,1,4,2,5,4,1,1,1,1,1,1,4,3,3,1,1,1,1,3,1,1,1,3,4,1,1,1,1,1,1,1,1,1,1,1,1,3,2,4,1,2,1,4,4,1,4,1,1,1,5,1,1,4,1,1,1,1,1,5,1,1,2,4,2,4,4,4,1,1,1,1,4,1,4,3,2,4,1,3,4,1,1,1,1,2,2,2,1,1,1,4,5,5,1,1,1,1,1,1,4,5,1,3,4,3,5,1,1,4,1,1,1,1,4,3,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,4,4,4,4,1,1,1,1,1,1,1,1,3,1,1,4,1,1,4,1,1,1,1,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,4,4,2,1,1,2,2,3,4,5,5,4,3,1,1,1,1,1,1,1,4,5,5,5,5,3) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 128 | 128 | GAGAATCAAAATCGGTGAATNGG | GGGCATCAAAATTGGTGAAGAGG | 16 | 75830134 | 75830157 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 129 | 129 | GAGAATCAAAATCGGTGAATNGG | GGGCATCCAAATCGGTGAAGAGG | X | 55315831 | 55315854 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 130 | 130 | GAGAATCAAAATCGGTGAATNGG | GGGCATCCAAATCGGTGAAGAGG | 12 | 87147601 | 87147624 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 131 | 131 | GAGAATCAAAATCGGTGAATNGG | GGGCATCCAAATCGGTGAAGAGG | 5 | 44608016 | 44608039 | + | 4 | ['lncRNA'] | transcript | ENSG00000249203 | LINC02224 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 132 | 132 | GAGAATCAAAATCGGTGAATNGG | GTGAAACAAAATCAATGAATGGG | 11 | 82968767 | 82968790 | - | 4 | ['protein_coding'] | transcript | ENSG00000137509,ENSG00000254698 | ENSG00000254698,PRCP | NaN | NaN | NaN | NaN | NaN | NaN | NaN | PRCP:(2,1,1,1,5,1,1,1,1,1,2,1,2,1,2,2,3,4,1,1,1,1,1,1,2,4,4,1,1,1,1,5,1,1,1,4,5,1,1,1,1,1,1,1,1,1,1,1,1,2,4,4,1,2,1,2,2,1,4,1,1,1,2,1,1,4,1,1,1,1,1,2,1,1,4,4,2,4,4,2,1,1,1,1,4,1,2,2,4,4,1,2,5,1,1,1,1,2,4,2,1,1,1,4,4,4,1,1,1,1,1,1,3,2,2,2,2,4,4,1,1,3,1,1,1,1,2,4,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,4,4,2,4,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,3,2,2,2,1,2,3,5,2,3,2,4,1,2,2,2,2,2,3,2,4,3,3,3,3,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 133 | 133 | GAGAATCAAAATCGGTGAATNGG | GTGAATCAAAATCTGAGAGTGGG | 1 | 220067876 | 220067899 | + | 4 | ['protein_coding'] | transcript | ENSG00000162813 | BPNT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | BPNT1:(4,1,1,1,5,1,1,1,1,1,4,1,2,1,4,4,4,4,3,4,2,4,4,3,1,2,2,1,1,1,1,2,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,4,3,2,1,2,1,4,4,1,4,1,1,1,4,1,1,4,1,1,1,1,1,5,1,1,3,4,2,4,4,5,2,2,4,4,1,2,5,4,2,3,1,3,5,1,1,1,1,2,3,4,1,1,1,4,4,2,1,1,1,1,1,1,1,4,4,4,4,3,4,1,1,4,1,1,1,1,3,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,5,4,5,4,1,1,1,1,1,1,1,1,4,1,1,4,1,1,4,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,5,4,4,4,4,4,4,2,2,4,4,5,4,1,1,1,1,1,1,1,4,2,2,2,5,4) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 134 | 134 | GAGAATCAAAATCGGTGAATNGG | TAAAATCAAAAGGGGTGAATTGG | 7 | 106100043 | 106100066 | + | 4 | ['protein_coding'] | transcript | ENSG00000008282 | SYPL1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | SYPL1:(2,1,1,1,4,1,1,1,1,1,4,1,5,1,4,2,4,4,1,1,1,1,1,1,4,2,3,1,1,1,1,3,1,1,1,2,2,1,1,1,1,1,1,1,1,1,1,1,1,4,2,2,1,3,1,4,2,1,2,1,1,1,4,1,1,3,1,1,1,1,1,5,1,1,2,4,2,4,4,4,1,1,1,1,5,1,5,3,2,3,1,4,5,1,1,1,1,4,3,4,1,1,1,3,5,4,1,1,1,1,1,1,4,4,1,3,4,3,1,1,1,2,1,1,1,1,4,4,1,1,1,1,1,5,1,1,1,1,1,1,1,1,1,1,1,5,4,3,3,1,1,1,1,1,1,1,1,3,1,1,3,1,1,3,1,1,1,1,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,5,1,1,3,2,3,2,1,3,2,4,5,5,5,4,1,5,5,2,4,5,2,4,4,5,4,4,5,3) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 135 | 135 | GAGAATCAAAATCGGTGAATNGG | TAGAATCAAAATAGCTGAACTGG | Y | 16783587 | 16783610 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 136 | 136 | GAGAATCAAAATCGGTGAATNGG | TAGAATCAGAATAGGAGAATGGG | 1 | 82986200 | 82986223 | - | 4 | ['lncRNA'] | exon,transcript | ENSG00000236268,ENSG00000230817 | LINC01361,LINC01362 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 137 | 137 | GAGAATCAAAATCGGTGAATNGG | TAGAATCAGAATCAGTGAAAGGG | 4 | 66084287 | 66084310 | - | 4 | ['lncRNA'] | transcript | ENSG00000249413 | ENSG00000249413 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 138 | 138 | GAGAATCAAAATCGGTGAATNGG | TAGAATCAGAATTGGTGACTAGG | 2 | 7150543 | 7150566 | + | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 139 | 139 | GAGAATCAAAATCGGTGAATNGG | TAGAATCAGAATTGGTGATTTGG | 18 | 77854868 | 77854891 | - | 4 | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 140 | 140 | GAGAATCAAAATCGGTGAATNGG | TAGAATCTAAATTGGTGACTCGG | 3 | 62710675 | 62710698 | - | 4 | ['protein_coding'] | transcript | ENSG00000163618 | CADPS | NaN | NaN | NaN | NaN | NaN | NaN | NaN | CADPS:(2,1,1,1,2,1,5,2,2,1,1,2,1,2,2,2,2,2,1,1,1,1,1,1,2,2,3,2,2,2,2,1,2,2,2,1,1,5,2,2,5,2,2,4,4,2,2,2,2,2,2,2,1,4,1,2,2,2,2,2,2,2,1,2,3,5,5,3,1,2,1,1,2,5,2,2,2,2,2,2,1,1,1,1,2,1,2,3,2,3,1,2,2,1,1,1,1,2,2,2,1,1,1,2,2,2,1,1,1,1,1,1,2,2,2,2,3,5,2,1,1,1,1,1,1,1,2,2,5,2,3,2,2,1,2,2,5,1,1,1,1,1,1,1,1,2,2,2,1,1,2,2,2,2,1,2,2,1,2,2,1,2,2,2,2,2,1,2,2,2,2,1,2,1,2,2,2,2,2,2,1,2,5,2,1,2,1,2,5,2,2,2,1,1,2,4,2,2,3,4,2,2,1,1,1,1,1,1,1,2,2,2,2,2,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| 141 | 141 | GAGAATCAAAATCGGTGAATNGG | TAGAGTTGAAATCGGTGAATAGG | X | 6864115 | 6864138 | + | 4 | ['protein_coding'] | gene | ENSG00000130021 | PUDP | NaN | NaN | NaN | NaN | NaN | NaN | NaN | PUDP:(3,1,1,1,5,1,1,1,1,1,4,1,4,1,3,1,4,4,1,1,1,1,1,1,4,2,3,1,1,1,1,2,1,1,1,3,4,1,1,1,1,1,1,1,1,1,1,1,1,2,2,3,1,2,1,3,2,1,2,1,1,1,4,1,1,3,1,1,1,1,1,4,1,1,2,3,2,4,2,2,1,1,1,1,4,1,4,4,2,3,1,3,5,1,1,1,1,3,4,1,2,4,2,4,2,2,1,1,1,1,1,1,4,2,4,2,4,4,5,1,1,3,1,1,1,1,4,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,3,3,2,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,3,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,4,2,4,1,1,1,2,3,4,4,4,5,5,1,1,1,1,1,1,1,5,2,2,2,4,2) | [] | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 142 | 142 | GAGAATCAAAATCGGTGAATNGG | TATAATCAAAATTGGAGAATAGG | 12 | 40294380 | 40294403 | - | 4 | ['protein_coding'] | transcript | ENSG00000188906 | LRRK2 | {Parkinson disease 8}, 607060 (3) | Autosomal dominant | NaN | NaN | NaN | NaN | TF cofactors | LRRK2:(2,1,1,1,2,1,1,1,1,1,3,1,2,1,2,2,2,2,1,1,1,1,1,1,3,2,3,1,1,1,1,3,1,1,1,3,3,1,1,1,1,1,1,1,1,1,1,1,1,3,2,2,1,2,1,2,2,1,2,1,1,1,2,1,1,2,1,1,1,1,1,2,1,1,2,2,2,2,3,2,1,1,1,1,2,1,2,3,2,2,1,2,5,1,1,1,1,3,3,4,1,1,1,3,2,2,1,1,1,1,1,1,2,2,2,2,3,2,2,1,1,2,1,1,1,1,2,2,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,2,2,3,2,1,1,1,1,1,1,1,1,2,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,1,1,2,1,1,2,2,2,2,2,2,2,2,2,2,3,2,3,1,1,1,1,1,1,1,2,3,2,3,2,2) | [] | NaN | [''] | [''] | [''] | NaN | [''] | [''] | [''] | Low_coding |
| Off Target ID | crRNA | DNA | Chromosome | Start | End | Strand | Mismatches | Gene Type | Feature | Gene Ensembl Id | Gene Symbol | OMIM Phenotype | OMIM Inheritance Model | Role in Cancer | Promoter of Gene (ENSG) | Gene(Promoter) Symbol | Gene(Promoter) Phenotype | Gene(Promoter) Inheritance model | Gene(Promoter) Role in Cancer | Enhancer of Gene (ENSG) | Gene(Enhancer) Symbol | Gene(Enhancer) Phenotype | Gene(Enhancer) Inheritance Model | Gene(Enhancer) Role in Cancer | Risk_Score | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 1 | GAGAATCAAAATCGGTGAATNGG | AAAAACCAAAATCGGTGTATCGG | 10 | 8060818 | 8060841 | - | 4 | protein_coding | transcript | ENSG00000107485 | GATA3 | Hypoparathyroidism, sensorineural deafness, and renal dysplasia, 146255 (3) | Autosomal dominant | oncogene, TSG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 1 | 3 | GAGAATCAAAATCGGTGAATNGG | AAGAAAAAAAATAGGTGAATTGG | 9 | 77194978 | 77195001 | - | 4 | protein_coding | transcript | ENSG00000197969 | VPS13A | Choreoacanthocytosis, 200150 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000197969 | VPS13A | Choreoacanthocytosis, 200150 (3) | Autosomal recessive | NaN | Low_coding |
| 2 | 3 | GAGAATCAAAATCGGTGAATNGG | AAGAAAAAAAATAGGTGAATTGG | 9 | 77194978 | 77195001 | - | 4 | protein_coding | transcript | ENSG00000197969 | VPS13A | Choreoacanthocytosis, 200150 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000232998 | RP11-470P4.2 | NaN | NaN | NaN | Low_coding |
| 3 | 4 | GAGAATCAAAATCGGTGAATNGG | AAGAAACAAAAACGGTGAGTTGG | 8 | 10616436 | 10616459 | - | 4 | protein_coding | exon | ENSG00000183638 | RP1L1 | Retinitis pigmentosa 88, 618826 (3), ; Occult macular dystrophy, 613587 (3) | Autosomal dominant Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High_coding |
| 4 | 15 | GAGAATCAAAATCGGTGAATNGG | AAGAATCATTATCGGTAAATTGG | 16 | 85555199 | 85555222 | - | 4 | protein_coding | transcript | ENSG00000131149 | GSE1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 5 | 16 | GAGAATCAAAATCGGTGAATNGG | AAGTATAAAAATCGGTGAAAGGG | 21 | 35354568 | 35354591 | - | 4 | protein_coding | transcript | ENSG00000159216 | RUNX1 | Platelet disorder, familial, with associated myeloid malignancy, 601399 (3), ; Leukemia, acute myeloid, 601626 (3), Somatic mutation | Autosomal dominant | oncogene, TSG, fusion | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 6 | 20 | GAGAATCAAAATCGGTGAATNGG | CAGAAGAAAAATCGATGAATTGG | 11 | 62438670 | 62438693 | - | 4 | protein_coding | transcript | ENSG00000124942 | AHNAK | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 7 | 21 | GAGAATCAAAATCGGTGAATNGG | CAGAATAAAACTCGGTGAACAGG | 7 | 110843608 | 110843631 | + | 4 | protein_coding | transcript | ENSG00000184903 | IMMP2L | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 8 | 24 | GAGAATCAAAATCGGTGAATNGG | CTGAATCAAAATCAGTGAAGTGG | 2 | 70721232 | 70721255 | - | 4 | protein_coding | transcript | ENSG00000075340 | ADD2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000152672 | CLEC4F | NaN | NaN | NaN | Low_coding |
| 9 | 24 | GAGAATCAAAATCGGTGAATNGG | CTGAATCAAAATCAGTGAAGTGG | 2 | 70721232 | 70721255 | - | 4 | protein_coding | transcript | ENSG00000075340 | ADD2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000237751 | AC007040.5 | NaN | NaN | NaN | Low_coding |
| 10 | 24 | GAGAATCAAAATCGGTGAATNGG | CTGAATCAAAATCAGTGAAGTGG | 2 | 70721232 | 70721255 | - | 4 | protein_coding | transcript | ENSG00000075340 | ADD2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000231386 | AC007395.4 | NaN | NaN | NaN | Low_coding |
| 11 | 24 | GAGAATCAAAATCGGTGAATNGG | CTGAATCAAAATCAGTGAAGTGG | 2 | 70721232 | 70721255 | - | 4 | protein_coding | transcript | ENSG00000075340 | ADD2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000124357 | NAGK | NaN | NaN | NaN | Low_coding |
| 12 | 24 | GAGAATCAAAATCGGTGAATNGG | CTGAATCAAAATCAGTGAAGTGG | 2 | 70721232 | 70721255 | - | 4 | protein_coding | transcript | ENSG00000075340 | ADD2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000116035 | VAX2 | NaN | NaN | NaN | Low_coding |
| 13 | 24 | GAGAATCAAAATCGGTGAATNGG | CTGAATCAAAATCAGTGAAGTGG | 2 | 70721232 | 70721255 | - | 4 | protein_coding | transcript | ENSG00000075340 | ADD2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000075340 | ADD2 | NaN | NaN | NaN | Low_coding |
| 14 | 27 | GAGAATCAAAATCGGTGAATNGG | GAAAATAAAAATGAGTGAATAGG | 20 | 9405588 | 9405611 | + | 4 | protein_coding | transcript | ENSG00000101333 | PLCB4 | Auriculocondylar syndrome 2, 614669 (3) | Autosomal dominant Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 15 | 28 | GAGAATCAAAATCGGTGAATNGG | GAAAATAAAAGTGGGTGAATTGG | X | 119688103 | 119688126 | + | 4 | protein_coding | transcript | ENSG00000125354 | SEPTIN6 | NaN | NaN | fusion | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 16 | 31 | GAGAATCAAAATCGGTGAATNGG | GAAAATCTAAATAGGTGAAAAGG | 15 | 74016587 | 74016610 | + | 4 | protein_coding | transcript | ENSG00000140464 | PML | Leukemia, acute promyelocytic, PML/RARA type (3) | NaN | TSG, fusion | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 17 | 33 | GAGAATCAAAATCGGTGAATNGG | GAAAGTCAGAATAGGTGAATGGG | 18 | 8717824 | 8717847 | + | 4 | protein_coding | exon | ENSG00000168502 | MTCL1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000206418 | RAB12 | NaN | NaN | NaN | Medium_coding |
| 18 | 33 | GAGAATCAAAATCGGTGAATNGG | GAAAGTCAGAATAGGTGAATGGG | 18 | 8717824 | 8717847 | + | 4 | protein_coding | exon | ENSG00000168502 | MTCL1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000168502 | SOGA2 | NaN | NaN | NaN | Medium_coding |
| 19 | 33 | GAGAATCAAAATCGGTGAATNGG | GAAAGTCAGAATAGGTGAATGGG | 18 | 8717824 | 8717847 | + | 4 | protein_coding | exon | ENSG00000168502 | MTCL1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000101745 | ANKRD12 | NaN | NaN | NaN | Medium_coding |
| 20 | 34 | GAGAATCAAAATCGGTGAATNGG | GAAATCCAAAATTGGTGAATTGG | 3 | 138570394 | 138570417 | - | 4 | protein_coding | exon | ENSG00000114107 | CEP70 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium_coding |
| 21 | 35 | GAGAATCAAAATCGGTGAATNGG | GAAATTAAAAATCAGTGAATAGG | 14 | 52741736 | 52741759 | - | 4 | protein_coding | transcript | ENSG00000198252 | STYX | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 22 | 37 | GAGAATCAAAATCGGTGAATNGG | GAAGAACAAAATCGGTGTATGGG | 8 | 29134612 | 29134635 | + | 4 | protein_coding | transcript | ENSG00000197892 | KIF13B | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 23 | 38 | GAGAATCAAAATCGGTGAATNGG | GAGAAAAAAAATCAGGGAATCGG | 5 | 133478181 | 133478204 | - | 4 | protein_coding | transcript | ENSG00000053108 | FSTL4 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 24 | 42 | GAGAATCAAAATCGGTGAATNGG | GAGAAACAAAATGGGTGGTTTGG | 4 | 61281927 | 61281950 | - | 4 | protein_coding | transcript | ENSG00000150471 | ADGRL3 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 25 | 43 | GAGAATCAAAATCGGTGAATNGG | GAGAAACAAAGTCTGTGAACTGG | 3 | 108362304 | 108362327 | - | 4 | protein_coding | transcript | ENSG00000114455 | HHLA2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 26 | 45 | GAGAATCAAAATCGGTGAATNGG | GAGAAACAGAATAGGTGTATGGG | 8 | 35450773 | 35450796 | - | 4 | protein_coding | transcript | ENSG00000156687 | UNC5D | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 27 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259279 | CTD-2033D15.1 | NaN | NaN | NaN | Low_coding |
| 28 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259345 | RP11-624L4.1 | NaN | NaN | NaN | Low_coding |
| 29 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259389 | RP11-325N19.2 | NaN | NaN | NaN | Low_coding |
| 30 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259269 | RP11-624L4.2 | NaN | NaN | NaN | Low_coding |
| 31 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000248508 | RP11-521C20.4 | NaN | NaN | NaN | Low_coding |
| 32 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000246863 | RP11-325N19.3 | NaN | NaN | NaN | Low_coding |
| 33 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259580 | RP11-37C7.1 | NaN | NaN | NaN | Low_coding |
| 34 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000261136 | RP11-37C7.3 | NaN | NaN | NaN | Low_coding |
| 35 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259584 | RP11-521C20.2 | NaN | NaN | NaN | Low_coding |
| 36 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259409 | RP11-521C20.3 | NaN | NaN | NaN | Low_coding |
| 37 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259536 | RP11-111A22.1 | NaN | NaN | NaN | Low_coding |
| 38 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259450 | RP11-265N7.1 | NaN | NaN | NaN | Low_coding |
| 39 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259447 | RP11-462P6.1 | NaN | NaN | NaN | Low_coding |
| 40 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259432 | RP11-37C7.2 | NaN | NaN | NaN | Low_coding |
| 41 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000137801 | THBS1 | NaN | NaN | NaN | Low_coding |
| 42 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000150667 | FSIP1 | NaN | NaN | NaN | Low_coding |
| 43 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000140320 | BAHD1 | NaN | NaN | NaN | Low_coding |
| 44 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000140319 | SRP14 | NaN | NaN | NaN | Low_coding |
| 45 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000128944 | C15orf23 | NaN | NaN | oncogene | Low_coding |
| 46 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000128829 | EIF2AK4 | Pulmonary venoocclusive disease 2, 234810 (3) | Autosomal recessive | NaN | Low_coding |
| 47 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000104081 | BMF | NaN | NaN | NaN | Low_coding |
| 48 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000244705 | RP11-133K1.1 | NaN | NaN | NaN | Low_coding |
| 49 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000244251 | RP11-64K12.1 | NaN | NaN | NaN | Low_coding |
| 50 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000238564 | snoU13 | NaN | NaN | NaN | Low_coding |
| 51 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000188549 | C15orf52 | NaN | NaN | NaN | Low_coding |
| 52 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000175746 | C15orf54 | NaN | NaN | NaN | Low_coding |
| 53 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000166133 | RPUSD2 | NaN | NaN | NaN | Low_coding |
| 54 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000166073 | GPR176 | NaN | NaN | NaN | Low_coding |
| 55 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | protein_coding | transcript | ENSG00000137801 | THBS1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000156970 | BUB1B | Colorectal cancer, somatic, 114500 (3); [Premature chromatid separation trait], 176430 (3), ; Mosaic variegated aneuploidy syndrome 1, 257300 (3) | Autosomal dominant Autosomal recessive | TSG | Low_coding |
| 56 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259279 | CTD-2033D15.1 | NaN | NaN | NaN | Low_regulatory |
| 57 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259345 | RP11-624L4.1 | NaN | NaN | NaN | Low_regulatory |
| 58 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259389 | RP11-325N19.2 | NaN | NaN | NaN | Low_regulatory |
| 59 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259269 | RP11-624L4.2 | NaN | NaN | NaN | Low_regulatory |
| 60 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000248508 | RP11-521C20.4 | NaN | NaN | NaN | Low_regulatory |
| 61 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000246863 | RP11-325N19.3 | NaN | NaN | NaN | Low_regulatory |
| 62 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259580 | RP11-37C7.1 | NaN | NaN | NaN | Low_regulatory |
| 63 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000261136 | RP11-37C7.3 | NaN | NaN | NaN | Low_regulatory |
| 64 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259584 | RP11-521C20.2 | NaN | NaN | NaN | Low_regulatory |
| 65 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259409 | RP11-521C20.3 | NaN | NaN | NaN | Low_regulatory |
| 66 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259536 | RP11-111A22.1 | NaN | NaN | NaN | Low_regulatory |
| 67 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259450 | RP11-265N7.1 | NaN | NaN | NaN | Low_regulatory |
| 68 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259447 | RP11-462P6.1 | NaN | NaN | NaN | Low_regulatory |
| 69 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000259432 | RP11-37C7.2 | NaN | NaN | NaN | Low_regulatory |
| 70 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000137801 | THBS1 | NaN | NaN | NaN | Low_regulatory |
| 71 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000150667 | FSIP1 | NaN | NaN | NaN | Low_regulatory |
| 72 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000140320 | BAHD1 | NaN | NaN | NaN | Low_regulatory |
| 73 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000140319 | SRP14 | NaN | NaN | NaN | Low_regulatory |
| 74 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000128944 | C15orf23 | NaN | NaN | oncogene | Medium_regulatory |
| 75 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000128829 | EIF2AK4 | Pulmonary venoocclusive disease 2, 234810 (3) | Autosomal recessive | NaN | Medium_regulatory |
| 76 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000104081 | BMF | NaN | NaN | NaN | Low_regulatory |
| 77 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000244705 | RP11-133K1.1 | NaN | NaN | NaN | Low_regulatory |
| 78 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000244251 | RP11-64K12.1 | NaN | NaN | NaN | Low_regulatory |
| 79 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000238564 | snoU13 | NaN | NaN | NaN | Low_regulatory |
| 80 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000188549 | C15orf52 | NaN | NaN | NaN | Low_regulatory |
| 81 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000175746 | C15orf54 | NaN | NaN | NaN | Low_regulatory |
| 82 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000166133 | RPUSD2 | NaN | NaN | NaN | Low_regulatory |
| 83 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000166073 | GPR176 | NaN | NaN | NaN | Low_regulatory |
| 84 | 46 | GAGAATCAAAATCGGTGAATNGG | GAGAAAGAAAATCAATGAATAGG | 15 | 39586806 | 39586829 | + | 4 | lncRNA | exon | ENSG00000276107 | THBS1-IT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000156970 | BUB1B | Colorectal cancer, somatic, 114500 (3); [Premature chromatid separation trait], 176430 (3), ; Mosaic variegated aneuploidy syndrome 1, 257300 (3) | Autosomal dominant Autosomal recessive | TSG | Medium_regulatory |
| 85 | 48 | GAGAATCAAAATCGGTGAATNGG | GAGAAATAGAATCAGTGAATGGG | 11 | 78406995 | 78407018 | + | 4 | protein_coding | transcript | ENSG00000033327 | GAB2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 86 | 49 | GAGAATCAAAATCGGTGAATNGG | GAGAACCAAAATCAATGAGTAGG | 10 | 116159111 | 116159134 | + | 4 | protein_coding | transcript | ENSG00000151892 | GFRA1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 87 | 52 | GAGAATCAAAATCGGTGAATNGG | GAGAACTAAAATAGGTTAATGGG | 21 | 43541253 | 43541276 | - | 4 | protein_coding | transcript | ENSG00000160207 | HSF2BP | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 88 | 54 | GAGAATCAAAATCGGTGAATNGG | GAGAAGAAAAATGGGTGAACGGG | 12 | 129565058 | 129565081 | + | 4 | protein_coding | transcript | ENSG00000151952 | TMEM132D | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 89 | 57 | GAGAATCAAAATCGGTGAATNGG | GAGAAGCAAGATGGGTTAATAGG | 3 | 133628781 | 133628804 | + | 4 | protein_coding | transcript | ENSG00000163781 | TOPBP1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 90 | 60 | GAGAATCAAAATCGGTGAATNGG | GAGAATAAAAATCGGGGAGCAGG | 3 | 29620001 | 29620024 | + | 4 | protein_coding | transcript | ENSG00000144642 | RBMS3 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 91 | 63 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAAAGACGTGAAGAGG | 22 | 41470840 | 41470863 | - | 4 | protein_coding | transcript | ENSG00000100412 | ACO2 | Infantile cerebellar-retinal degeneration, 614559 (3), ; ?Optic atrophy 9, 616289 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 92 | 68 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAAATTTCTGAAGAGG | X | 68155622 | 68155645 | - | 4 | protein_coding | transcript | ENSG00000079482 | OPHN1 | Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486 (3) | X-linked recessive | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 93 | 69 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAAACCAGGTGAAGGGG | 7 | 81767131 | 81767154 | - | 4 | protein_coding | transcript | ENSG00000019991 | HGF | Deafness, autosomal recessive 39, 608265 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 94 | 70 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAATATCACTGAAATGG | 16 | 80999456 | 80999479 | + | 4 | protein_coding | transcript | ENSG00000286221 | ENSG00000286221 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 95 | 70 | GAGAATCAAAATCGGTGAATNGG | GAGAATCAATATCACTGAAATGG | 16 | 80999456 | 80999479 | + | 4 | protein_coding | transcript | ENSG00000103121 | CMC2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 96 | 75 | GAGAATCAAAATCGGTGAATNGG | GAGAATCACAATCGGTCCACTGG | 1 | 182382367 | 182382390 | + | 4 | protein_coding | exon | ENSG00000135821 | GLUL | Glutamine deficiency, congenital, 610015 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High_coding |
| 97 | 76 | GAGAATCAAAATCGGTGAATNGG | GAGAATCATAATCAATGAACTGG | 10 | 60975179 | 60975202 | + | 4 | protein_coding | transcript | ENSG00000072422 | RHOBTB1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 98 | 78 | GAGAATCAAAATCGGTGAATNGG | GAGAATCCAAATTGGTAAAGAGG | 3 | 102367220 | 102367243 | - | 4 | protein_coding | transcript | ENSG00000170044 | ZPLD1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 99 | 80 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAACGAGGAATTGG | 2 | 63889184 | 63889207 | + | 4 | protein_coding | transcript | ENSG00000169764 | UGP2 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000197329 | PELI1 | NaN | NaN | NaN | Low_coding |
| 100 | 80 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAACGAGGAATTGG | 2 | 63889184 | 63889207 | + | 4 | protein_coding | transcript | ENSG00000169764 | UGP2 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000225889 | AC074289.1 | NaN | NaN | NaN | Low_coding |
| 101 | 80 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAACGAGGAATTGG | 2 | 63889184 | 63889207 | + | 4 | protein_coding | transcript | ENSG00000169764 | UGP2 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000228079 | AC012368.1 | NaN | NaN | NaN | Low_coding |
| 102 | 80 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAACGAGGAATTGG | 2 | 63889184 | 63889207 | + | 4 | protein_coding | transcript | ENSG00000169764 | UGP2 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000228872 | AC096664.2 | NaN | NaN | NaN | Low_coding |
| 103 | 80 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAACGAGGAATTGG | 2 | 63889184 | 63889207 | + | 4 | protein_coding | transcript | ENSG00000169764 | UGP2 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000234488 | AC096664.1 | NaN | NaN | NaN | Low_coding |
| 104 | 80 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAACGAGGAATTGG | 2 | 63889184 | 63889207 | + | 4 | protein_coding | transcript | ENSG00000169764 | UGP2 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000251775 | ACA59 | NaN | NaN | NaN | Low_coding |
| 105 | 80 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAACGAGGAATTGG | 2 | 63889184 | 63889207 | + | 4 | protein_coding | transcript | ENSG00000169764 | UGP2 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000143952 | VPS54 | NaN | NaN | NaN | Low_coding |
| 106 | 80 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAACGAGGAATTGG | 2 | 63889184 | 63889207 | + | 4 | protein_coding | transcript | ENSG00000169764 | UGP2 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000169764 | UGP2 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive | NaN | Low_coding |
| 107 | 80 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAACGAGGAATTGG | 2 | 63889184 | 63889207 | + | 4 | protein_coding | transcript | ENSG00000169764 | UGP2 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000143951 | WDPCP | ?Bardet-Biedl syndrome 15, 615992 (3), ; Congenital heart defects, hamartomas of tongue, and polysyndactyly, 217085 (3) | Autosomal recessive | NaN | Low_coding |
| 108 | 82 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAAGAGATGAATAGG | 10 | 79560000 | 79560023 | + | 4 | protein_coding | exon | ENSG00000185303 | SFTPA2 | Pulmonary fibrosis, idiopathic, 178500 (3) | Autosomal dominant | NaN | ENSG00000185303 | SFTPA2_1 | Pulmonary fibrosis, idiopathic, 178500 (3) | Autosomal dominant | NaN | NaN | NaN | NaN | NaN | NaN | High_coding |
| 109 | 83 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAAAATAGATGATTGGG | 7 | 34029247 | 34029270 | + | 4 | protein_coding | transcript | ENSG00000164619 | BMPER | Diaphanospondylodysostosis, 608022 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 110 | 86 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAATATTGGGGAATTGG | 1 | 236265989 | 236266012 | - | 4 | protein_coding | transcript | ENSG00000086619 | ERO1B | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 111 | 87 | GAGAATCAAAATCGGTGAATNGG | GAGAATGAATGTGGGTGAATGGG | 8 | 19464151 | 19464174 | - | 4 | protein_coding | transcript | ENSG00000147408 | CSGALNACT1 | Skeletal dysplasia, mild, with joint laxity and advanced bone age, 618870 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 112 | 91 | GAGAATCAAAATCGGTGAATNGG | GAGAATTAAAATCGGTGCGAAGG | 16 | 21747344 | 21747367 | - | 4 | protein_coding | transcript | ENSG00000155719 | OTOA | Deafness, autosomal recessive 22, 607039 (3) | Autosomal recessive | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 113 | 92 | GAGAATCAAAATCGGTGAATNGG | GAGAATTACAATCAATGAATGGG | 11 | 62125897 | 62125920 | + | 4 | protein_coding | transcript | ENSG00000149503 | INCENP | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 114 | 94 | GAGAATCAAAATCGGTGAATNGG | GAGACTCAAAAGTCGTGAATGGG | 10 | 67626654 | 67626677 | + | 4 | protein_coding | transcript | ENSG00000183230 | CTNNA3 | Arrhythmogenic right ventricular dysplasia, familial, 13, 615616 (3) | Autosomal dominant | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 115 | 98 | GAGAATCAAAATCGGTGAATNGG | GAGAGCGAAAATCAGTGAATCGG | 13 | 112491135 | 112491158 | - | 4 | protein_coding | transcript | ENSG00000126216 | TUBGCP3 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 116 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000128626 | MRPS12 | NaN | NaN | NaN | Low_coding |
| 117 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000130755 | GMFG | NaN | NaN | NaN | Low_coding |
| 118 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000176396 | EID2 | NaN | NaN | NaN | Low_coding |
| 119 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000176401 | EID2B | NaN | NaN | NaN | Low_coding |
| 120 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000179134 | SAMD4B | NaN | NaN | NaN | Low_coding |
| 121 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000213922 | AC011500.1 | NaN | NaN | NaN | Low_coding |
| 122 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000241983 | AC005239.1 | NaN | NaN | NaN | Low_coding |
| 123 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000196235 | SUPT5H | NaN | NaN | NaN | Low_coding |
| 124 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000128011 | LRFN1 | NaN | NaN | NaN | Low_coding |
| 125 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000006712 | PAF1 | NaN | NaN | NaN | Low_coding |
| 126 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000063322 | MED29 | NaN | NaN | NaN | Low_coding |
| 127 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000090924 | PLEKHG2 | Leukodystrophy and acquired microcephaly with or without dystonia, 616763 (3) | Autosomal recessive | NaN | Low_coding |
| 128 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000128016 | ZFP36 | NaN | NaN | NaN | Low_coding |
| 129 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000104823 | ECH1 | NaN | NaN | NaN | Low_coding |
| 130 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000105193 | RPS16 | NaN | NaN | NaN | Low_coding |
| 131 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000105197 | TIMM50 | 3-methylglutaconic aciduria, type IX, 617698 (3) | Autosomal recessive | NaN | Low_coding |
| 132 | 100 | GAGAATCAAAATCGGTGAATNGG | GAGATTCAAAGTCCATGAATAGG | 19 | 39332965 | 39332988 | + | 4 | protein_coding | transcript | ENSG00000130755 | GMFG | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000105205 | CLC | NaN | NaN | NaN | Low_coding |
| 133 | 103 | GAGAATCAAAATCGGTGAATNGG | GAGCATCAAAATCGGTAAAGAGG | X | 152319010 | 152319033 | + | 3 | protein_coding | transcript | ENSG00000011677 | GABRA3 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 134 | 106 | GAGAATCAAAATCGGTGAATNGG | GAGCATCCAAATCAGTGAAGAGG | 17 | 60795379 | 60795402 | - | 4 | protein_coding | transcript | ENSG00000141376 | BCAS3 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 135 | 110 | GAGAATCAAAATCGGTGAATNGG | GAGCATCCAAATCGGTAAAGAGG | 15 | 50174320 | 50174343 | + | 4 | protein_coding | transcript | ENSG00000104043 | ATP8B4 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 136 | 112 | GAGAATCAAAATCGGTGAATNGG | GAGCATCCAAATTGGTAAATAGG | 2 | 230261415 | 230261438 | - | 4 | protein_coding | transcript | ENSG00000079263 | SP140 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 137 | 113 | GAGAATCAAAATCGGTGAATNGG | GAGGATCAAAATCTGTAAAATGG | 6 | 157392057 | 157392080 | - | 4 | protein_coding | transcript | ENSG00000175048 | ZDHHC14 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 138 | 115 | GAGAATCAAAATCGGTGAATNGG | GAGTATGAAAATCGCTGAATAGG | 10 | 21110550 | 21110573 | - | 3 | protein_coding | transcript | ENSG00000078114 | NEBL | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000231920 | RP11-565H13.2 | NaN | NaN | NaN | Low_coding |
| 139 | 115 | GAGAATCAAAATCGGTGAATNGG | GAGTATGAAAATCGCTGAATAGG | 10 | 21110550 | 21110573 | - | 3 | protein_coding | transcript | ENSG00000078114 | NEBL | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000228860 | RP11-565H13.3 | NaN | NaN | NaN | Low_coding |
| 140 | 115 | GAGAATCAAAATCGGTGAATNGG | GAGTATGAAAATCGCTGAATAGG | 10 | 21110550 | 21110573 | - | 3 | protein_coding | transcript | ENSG00000078114 | NEBL | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000204683 | C10orf113 | NaN | NaN | NaN | Low_coding |
| 141 | 115 | GAGAATCAAAATCGGTGAATNGG | GAGTATGAAAATCGCTGAATAGG | 10 | 21110550 | 21110573 | - | 3 | protein_coding | transcript | ENSG00000078114 | NEBL | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ENSG00000078114 | NEBL | NaN | NaN | NaN | Low_coding |
| 142 | 119 | GAGAATCAAAATCGGTGAATNGG | GATAATCAAAATCAGTCCATTGG | 4 | 114944688 | 114944711 | - | 4 | protein_coding | transcript | ENSG00000138653 | NDST4 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 143 | 124 | GAGAATCAAAATCGGTGAATNGG | GGCAATCAATATCGGTGGATGGG | 16 | 71992820 | 71992843 | - | 4 | protein_coding | transcript | ENSG00000277481 | PKD1L3 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 144 | 127 | GAGAATCAAAATCGGTGAATNGG | GGGAATCAAAATAGGAGAACGGG | 1 | 23909844 | 23909867 | - | 4 | protein_coding | transcript | ENSG00000188822 | CNR2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 145 | 132 | GAGAATCAAAATCGGTGAATNGG | GTGAAACAAAATCAATGAATGGG | 11 | 82968767 | 82968790 | - | 4 | protein_coding | transcript | ENSG00000137509 | PRCP | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 146 | 133 | GAGAATCAAAATCGGTGAATNGG | GTGAATCAAAATCTGAGAGTGGG | 1 | 220067876 | 220067899 | + | 4 | protein_coding | transcript | ENSG00000162813 | BPNT1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 147 | 134 | GAGAATCAAAATCGGTGAATNGG | TAAAATCAAAAGGGGTGAATTGG | 7 | 106100043 | 106100066 | + | 4 | protein_coding | transcript | ENSG00000008282 | SYPL1 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 148 | 140 | GAGAATCAAAATCGGTGAATNGG | TAGAATCTAAATTGGTGACTCGG | 3 | 62710675 | 62710698 | - | 4 | protein_coding | transcript | ENSG00000163618 | CADPS | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| 149 | 142 | GAGAATCAAAATCGGTGAATNGG | TATAATCAAAATTGGAGAATAGG | 12 | 40294380 | 40294403 | - | 4 | protein_coding | transcript | ENSG00000188906 | LRRK2 | {Parkinson disease 8}, 607060 (3) | Autosomal dominant | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low_coding |
| off_target_id | ot_chromosome | ot_start | ot_end | gene_ensembl_id | gene_symbol | segment | start | end | strand | gene_type | transcript_ensembl_id | transcript_type | transcript_symbol | protein_id | exon_number | exon_id | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 1 | 10 | 8060818 | 8060841 | ENSG00000107485 | GATA3 | transcript | 8054688 | 8075198 | + | protein_coding | ENST00000379328.9 | protein_coding | GATA3-202 | ENSP00000368632.3 | NaN | NaN |
| 1 | 2 | 14 | 87782817 | 87782840 | ENSG00000258807 | ENSG00000258807 | transcript | 87710419 | 87872291 | - | lncRNA | ENST00000554305.5 | lncRNA | ENST00000554305 | NaN | NaN | NaN |
| 2 | 3 | 9 | 77194978 | 77195001 | ENSG00000197969 | VPS13A | transcript | 77177445 | 77417483 | + | protein_coding | ENST00000376636.7 | protein_coding | VPS13A-203 | ENSP00000365823.3 | NaN | NaN |
| 3 | 4 | 8 | 10616436 | 10616459 | ENSG00000183638 | RP1L1 | exon | 10616446 | 10616587 | - | protein_coding | ENST00000382483.4 | protein_coding | RP1L1-202 | ENSP00000371923.3 | 3.0 | ENSE00001492248.2 |
| 4 | 5 | 2 | 94883894 | 94883917 | ENSG00000291025 | ENSG00000291025 | transcript | 94867486 | 94947341 | - | lncRNA | ENST00000568768.5 | lncRNA | ENST00000568768 | NaN | NaN | NaN |
| 5 | 15 | 16 | 85555199 | 85555222 | ENSG00000131149 | GSE1 | transcript | 85169525 | 85634132 | + | protein_coding | ENST00000637419.1 | protein_coding | GSE1-216 | ENSP00000490157.1 | NaN | NaN |
| 6 | 16 | 21 | 35354568 | 35354591 | ENSG00000159216 | RUNX1 | transcript | 34887046 | 36004667 | - | protein_coding | ENST00000475045.6 | protein_coding | RUNX1-214 | ENSP00000477072.1 | NaN | NaN |
| 7 | 17 | 14 | 80418379 | 80418402 | ENSG00000258766 | DIO2-AS1 | transcript | 80211419 | 80455469 | + | lncRNA | ENST00000553979.1 | lncRNA | DIO2-AS1-201 | NaN | NaN | NaN |
| 8 | 18 | 2 | 187831089 | 187831112 | ENSG00000231689 | LINC01090 | transcript | 187712816 | 188287691 | - | lncRNA | ENST00000434418.2 | lncRNA | LINC01090-202 | NaN | NaN | NaN |
| 9 | 20 | 11 | 62438670 | 62438693 | ENSG00000124942 | AHNAK | transcript | 62433542 | 62536107 | - | protein_coding | ENST00000530124.5 | protein_coding | AHNAK-205 | ENSP00000433789.1 | NaN | NaN |
| 10 | 21 | 7 | 110843608 | 110843631 | ENSG00000184903 | IMMP2L | transcript | 110662644 | 111562492 | - | protein_coding | ENST00000405709.7 | protein_coding | IMMP2L-202 | ENSP00000384966.2 | NaN | NaN |
| 11 | 22 | 3 | 80655304 | 80655327 | ENSG00000286329 | ENSG00000286329 | transcript | 80602716 | 80677898 | - | lncRNA | ENST00000668251.1 | lncRNA | ENST00000668251 | NaN | NaN | NaN |
| 12 | 23 | 2 | 129252225 | 129252248 | ENSG00000204460 | LINC01854 | transcript | 129242173 | 129273848 | - | lncRNA | ENST00000375987.3 | lncRNA | LINC01854-201 | NaN | NaN | NaN |
| 13 | 24 | 2 | 70721232 | 70721255 | ENSG00000075340 | ADD2 | transcript | 70656784 | 70768200 | - | protein_coding | ENST00000264436.9 | protein_coding | ADD2-201 | ENSP00000264436.3 | NaN | NaN |
| 14 | 26 | 3 | 55242453 | 55242476 | ENSG00000240708 | LINC02030 | transcript | 55226862 | 55299803 | + | lncRNA | ENST00000654581.1 | lncRNA | LINC02030-202 | NaN | NaN | NaN |
| 15 | 27 | 20 | 9405588 | 9405611 | ENSG00000101333 | PLCB4 | transcript | 9067825 | 9481242 | + | protein_coding | ENST00000378501.3 | protein_coding | PLCB4-204 | ENSP00000367762.2 | NaN | NaN |
| 16 | 28 | X | 119688103 | 119688126 | ENSG00000125354 | SEPTIN6 | transcript | 119615724 | 119693370 | - | protein_coding | ENST00000360156.11 | protein_coding | SEPTIN6-204 | ENSP00000353278.7 | NaN | NaN |
| 17 | 31 | 15 | 74016587 | 74016610 | ENSG00000140464 | PML | transcript | 73994673 | 74043337 | + | protein_coding | ENST00000395135.7 | protein_coding | PML-206 | ENSP00000378567.3 | NaN | NaN |
| 18 | 33 | 18 | 8717824 | 8717847 | ENSG00000168502 | MTCL1 | exon | 8717759 | 8717962 | + | protein_coding | ENST00000523122.1 | protein_coding | MTCL1-213 | ENSP00000463506.1 | 1.0 | ENSE00002102166.1 |
| 19 | 34 | 3 | 138570394 | 138570417 | ENSG00000114107 | CEP70 | exon | 138570318 | 138570498 | - | protein_coding | ENST00000468900.5 | protein_coding | CEP70-206 | ENSP00000418131.2 | 5.0 | ENSE00003676297.1 |
| 20 | 35 | 14 | 52741736 | 52741759 | ENSG00000198252 | STYX | transcript | 52730166 | 52774989 | + | protein_coding | ENST00000354586.5 | protein_coding | STYX-201 | ENSP00000346599.4 | NaN | NaN |
| 21 | 37 | 8 | 29134612 | 29134635 | ENSG00000197892 | KIF13B | transcript | 29067278 | 29263070 | - | protein_coding | ENST00000524189.6 | protein_coding | KIF13B-206 | ENSP00000427900.1 | NaN | NaN |
| 22 | 37 | 8 | 29134612 | 29134635 | ENSG00000254129 | ENSG00000254129 | transcript | 29110573 | 29140681 | + | lncRNA | ENST00000523661.1 | lncRNA | ENST00000523661 | NaN | NaN | NaN |
| 23 | 38 | 5 | 133478181 | 133478204 | ENSG00000053108 | FSTL4 | transcript | 133196455 | 133612541 | - | protein_coding | ENST00000265342.12 | protein_coding | FSTL4-201 | ENSP00000265342.7 | NaN | NaN |
| 24 | 39 | 2 | 38211467 | 38211490 | ENSG00000227292 | ENSG00000227292 | transcript | 38203363 | 38239590 | - | lncRNA | ENST00000450854.1 | lncRNA | ENST00000450854 | NaN | NaN | NaN |
| 25 | 39 | 2 | 38211467 | 38211490 | ENSG00000232973 | CYP1B1-AS1 | transcript | 38075700 | 38231651 | + | lncRNA | ENST00000629773.2 | lncRNA | CYP1B1-AS1-232 | NaN | NaN | NaN |
| 26 | 42 | 4 | 61281927 | 61281950 | ENSG00000150471 | ADGRL3 | transcript | 61200326 | 62078335 | + | protein_coding | ENST00000683033.1 | protein_coding | ADGRL3-219 | ENSP00000507980.1 | NaN | NaN |
| 27 | 43 | 3 | 108362304 | 108362327 | ENSG00000114455 | HHLA2 | transcript | 108296546 | 108377278 | + | protein_coding | ENST00000491820.5 | protein_coding | HHLA2-209 | ENSP00000418284.1 | NaN | NaN |
| 28 | 45 | 8 | 35450773 | 35450796 | ENSG00000156687 | UNC5D | transcript | 35235475 | 35796540 | + | protein_coding | ENST00000404895.7 | protein_coding | UNC5D-202 | ENSP00000385143.2 | NaN | NaN |
| 29 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | transcript | 39581079 | 39599466 | + | protein_coding | ENST00000260356.6 | protein_coding | THBS1-201 | ENSP00000260356.5 | NaN | NaN |
| 30 | 46 | 15 | 39586806 | 39586829 | ENSG00000276107 | THBS1-IT1 | exon | 39586561 | 39587293 | + | lncRNA | ENST00000478845.2 | lncRNA | THBS1-IT1-201 | NaN | 1.0 | ENSE00001889980.2 |
| 31 | 47 | 12 | 89861523 | 89861546 | ENSG00000258216 | ENSG00000258216 | transcript | 89712048 | 90100763 | + | lncRNA | ENST00000651272.1 | lncRNA | ENST00000651272 | NaN | NaN | NaN |
| 32 | 48 | 11 | 78406995 | 78407018 | ENSG00000033327 | GAB2 | transcript | 78215293 | 78417820 | - | protein_coding | ENST00000361507.5 | protein_coding | GAB2-202 | ENSP00000354952.4 | NaN | NaN |
| 33 | 48 | 11 | 78406995 | 78407018 | ENSG00000254420 | ENSG00000254420 | transcript | 78324758 | 78444049 | + | lncRNA | ENST00000534168.1 | lncRNA | ENST00000534168 | NaN | NaN | NaN |
| 34 | 49 | 10 | 116159111 | 116159134 | ENSG00000151892 | GFRA1 | transcript | 116056925 | 116273206 | - | protein_coding | ENST00000355422.11 | protein_coding | GFRA1-201 | ENSP00000347591.6 | NaN | NaN |
| 35 | 50 | 13 | 50092090 | 50092113 | ENSG00000176124 | DLEU1 | transcript | 50082169 | 50107202 | + | lncRNA | ENST00000655550.1 | lncRNA | DLEU1-239 | NaN | NaN | NaN |
| 36 | 50 | 13 | 50092090 | 50092113 | ENSG00000231607 | DLEU2 | transcript | 49982552 | 50125541 | - | lncRNA | ENST00000621282.4 | lncRNA | DLEU2-207 | NaN | NaN | NaN |
| 37 | 52 | 21 | 43541253 | 43541276 | ENSG00000160207 | HSF2BP | transcript | 43529186 | 43659488 | - | protein_coding | ENST00000291560.7 | protein_coding | HSF2BP-201 | ENSP00000291560.2 | NaN | NaN |
| 38 | 54 | 12 | 129565058 | 129565081 | ENSG00000151952 | TMEM132D | transcript | 129071726 | 129904025 | - | protein_coding | ENST00000422113.7 | protein_coding | TMEM132D-202 | ENSP00000408581.2 | NaN | NaN |
| 39 | 55 | 2 | 207225277 | 207225300 | ENSG00000234902 | ENSG00000234902 | transcript | 207186717 | 207235883 | - | lncRNA | ENST00000417096.5 | lncRNA | ENST00000417096 | NaN | NaN | NaN |
| 40 | 55 | 2 | 207225277 | 207225300 | ENSG00000229647 | MYOSLID | transcript | 207166120 | 207248392 | + | lncRNA | ENST00000666421.1 | lncRNA | MYOSLID-205 | NaN | NaN | NaN |
| 41 | 56 | 18 | 51495041 | 51495064 | ENSG00000227115 | LINC01630 | transcript | 51346249 | 51516186 | + | lncRNA | ENST00000635503.2 | lncRNA | LINC01630-207 | NaN | NaN | NaN |
| 42 | 57 | 3 | 133628781 | 133628804 | ENSG00000163781 | TOPBP1 | transcript | 133600238 | 133661941 | - | protein_coding | ENST00000260810.10 | protein_coding | TOPBP1-201 | ENSP00000260810.5 | NaN | NaN |
| 43 | 60 | 3 | 29620001 | 29620024 | ENSG00000203506 | RBMS3-AS2 | transcript | 29526251 | 29642792 | - | lncRNA | ENST00000629416.2 | lncRNA | RBMS3-AS2-207 | NaN | NaN | NaN |
| 44 | 60 | 3 | 29620001 | 29620024 | ENSG00000283563 | ENSG00000283563 | gene | 28349178 | 29767537 | + | protein_coding | NaN | NaN | NaN | NaN | NaN | NaN |
| 45 | 60 | 3 | 29620001 | 29620024 | ENSG00000144642 | RBMS3 | transcript | 28576175 | 30004034 | + | protein_coding | ENST00000636680.2 | protein_coding | RBMS3-218 | ENSP00000490271.2 | NaN | NaN |
| 46 | 63 | 22 | 41470840 | 41470863 | ENSG00000100412 | ACO2 | transcript | 41447830 | 41529273 | + | protein_coding | ENST00000676748.1 | protein_coding | ACO2-209 | ENSP00000503371.1 | NaN | NaN |
| 47 | 64 | 14 | 22547572 | 22547595 | ENSG00000277734 | TRAC | exon | 22547506 | 22547778 | + | TR_C_gene | ENST00000611116.2 | TR_C_gene | TRAC-201 | ENSP00000480116.1 | 1.0 | ENSE00003753140.1 |
| 48 | 65 | 1 | 60145105 | 60145128 | ENSG00000238242 | LINC02778 | transcript | 60114875 | 60149679 | + | lncRNA | ENST00000456878.1 | lncRNA | LINC02778-201 | NaN | NaN | NaN |
| 49 | 68 | X | 68155622 | 68155645 | ENSG00000079482 | OPHN1 | transcript | 67949349 | 68433380 | - | protein_coding | ENST00000680612.1 | protein_coding | OPHN1-215 | ENSP00000505365.1 | NaN | NaN |
| 50 | 69 | 7 | 81767131 | 81767154 | ENSG00000019991 | HGF | transcript | 81699010 | 81770047 | - | protein_coding | ENST00000222390.11 | protein_coding | HGF-201 | ENSP00000222390.5 | NaN | NaN |
| 51 | 70 | 16 | 80999456 | 80999479 | ENSG00000103121 | CMC2 | transcript | 80966448 | 81006885 | - | protein_coding | ENST00000219400.8 | protein_coding | CMC2-201 | ENSP00000219400.3 | NaN | NaN |
| 52 | 70 | 16 | 80999456 | 80999479 | ENSG00000286221 | ENSG00000286221 | transcript | 80828736 | 81006894 | - | protein_coding | ENST00000651611.1 | protein_coding_CDS_not_defined | ENST00000651611 | NaN | NaN | NaN |
| 53 | 73 | 7 | 34521147 | 34521170 | ENSG00000197085 | NPSR1-AS1 | transcript | 34346512 | 34758234 | - | lncRNA | ENST00000419766.5 | lncRNA | NPSR1-AS1-202 | NaN | NaN | NaN |
| 54 | 74 | 3 | 34588687 | 34588710 | ENSG00000226320 | LINC01811 | transcript | 34208964 | 34676969 | + | lncRNA | ENST00000659779.1 | lncRNA | LINC01811-214 | NaN | NaN | NaN |
| 55 | 75 | 1 | 182382367 | 182382390 | ENSG00000135821 | GLUL | exon | 182378098 | 182384723 | - | protein_coding | ENST00000331872.11 | protein_coding | GLUL-202 | ENSP00000356537.6 | 7.0 | ENSE00000000279.2 |
| 56 | 76 | 10 | 60975179 | 60975202 | ENSG00000072422 | RHOBTB1 | transcript | 60869438 | 61001440 | - | protein_coding | ENST00000357917.4 | protein_coding | RHOBTB1-202 | ENSP00000350595.4 | NaN | NaN |
| 57 | 78 | 3 | 102367220 | 102367243 | ENSG00000170044 | ZPLD1 | transcript | 102099244 | 102477677 | + | protein_coding | ENST00000491959.5 | protein_coding | ZPLD1-204 | ENSP00000420265.1 | NaN | NaN |
| 58 | 80 | 2 | 63889184 | 63889207 | ENSG00000169764 | UGP2 | transcript | 63840969 | 63891451 | + | protein_coding | ENST00000467648.6 | protein_coding | UGP2-207 | ENSP00000420793.2 | NaN | NaN |
| 59 | 82 | 10 | 79560000 | 79560023 | ENSG00000185303 | SFTPA2 | exon | 79559969 | 79560163 | - | protein_coding | ENST00000417041.1 | protein_coding | SFTPA2-203 | ENSP00000397375.1 | 2.0 | ENSE00001686525.1 |
| 60 | 83 | 7 | 34029247 | 34029270 | ENSG00000164619 | BMPER | transcript | 33904308 | 34046374 | + | protein_coding | ENST00000436222.6 | protein_coding_CDS_not_defined | BMPER-202 | NaN | NaN | NaN |
| 61 | 85 | 5 | 118142872 | 118142895 | ENSG00000250891 | LINC02208 | transcript | 118000253 | 118562088 | - | lncRNA | ENST00000660173.1 | lncRNA | LINC02208-208 | NaN | NaN | NaN |
| 62 | 85 | 5 | 118142872 | 118142895 | ENSG00000249797 | LINC02147 | transcript | 117730515 | 118266256 | + | lncRNA | ENST00000661774.1 | lncRNA | LINC02147-204 | NaN | NaN | NaN |
| 63 | 86 | 1 | 236265989 | 236266012 | ENSG00000086619 | ERO1B | transcript | 236215101 | 236281958 | - | protein_coding | ENST00000354619.10 | protein_coding | ERO1B-202 | ENSP00000346635.5 | NaN | NaN |
| 64 | 87 | 8 | 19464151 | 19464174 | ENSG00000147408 | CSGALNACT1 | transcript | 19404161 | 19757277 | - | protein_coding | ENST00000692225.2 | protein_coding | CSGALNACT1-217 | ENSP00000509853.1 | NaN | NaN |
| 65 | 88 | 6 | 94593684 | 94593707 | ENSG00000289178 | ENSG00000289178 | transcript | 94546175 | 94735852 | - | lncRNA | ENST00000701797.1 | lncRNA | ENST00000701797 | NaN | NaN | NaN |
| 66 | 90 | 16 | 22563467 | 22563490 | ENSG00000290866 | OTOAP1 | transcript | 22545698 | 22576865 | + | lncRNA | ENST00000550753.5 | lncRNA | OTOAP1-202 | NaN | NaN | NaN |
| 67 | 90 | 16 | 22563467 | 22563490 | ENSG00000257838 | OTOAP1 | transcript | 22546964 | 22576682 | + | transcribed_unprocessed_pseudogene | ENST00000548889.1 | transcribed_unprocessed_pseudogene | OTOAP1-201 | NaN | NaN | NaN |
| 68 | 91 | 16 | 21747344 | 21747367 | ENSG00000155719 | OTOA | transcript | 21663968 | 21760729 | + | protein_coding | ENST00000646100.2 | protein_coding | OTOA-208 | ENSP00000496564.2 | NaN | NaN |
| 69 | 92 | 11 | 62125897 | 62125920 | ENSG00000149503 | INCENP | transcript | 62123998 | 62152752 | + | protein_coding | ENST00000278849.4 | protein_coding | INCENP-201 | ENSP00000278849.4 | NaN | NaN |
| 70 | 94 | 10 | 67626654 | 67626677 | ENSG00000183230 | CTNNA3 | transcript | 65912457 | 67665660 | - | protein_coding | ENST00000682758.1 | protein_coding | CTNNA3-208 | ENSP00000508047.1 | NaN | NaN |
| 71 | 95 | 16 | 30600288 | 30600311 | ENSG00000260167 | ENSG00000260167 | transcript | 30585907 | 30608593 | + | lncRNA | ENST00000563540.1 | lncRNA | ENST00000563540 | NaN | NaN | NaN |
| 72 | 98 | 13 | 112491135 | 112491158 | ENSG00000126216 | TUBGCP3 | transcript | 112485011 | 112588153 | - | protein_coding | ENST00000261965.8 | protein_coding | TUBGCP3-201 | ENSP00000261965.3 | NaN | NaN |
| 73 | 100 | 19 | 39332965 | 39332988 | ENSG00000130755 | GMFG | transcript | 39328353 | 39336017 | - | protein_coding | ENST00000601387.5 | protein_coding | GMFG-210 | ENSP00000471786.1 | NaN | NaN |
| 74 | 103 | X | 152319010 | 152319033 | ENSG00000011677 | GABRA3 | transcript | 152166234 | 152451315 | - | protein_coding | ENST00000370314.9 | protein_coding | GABRA3-201 | ENSP00000359337.4 | NaN | NaN |
| 75 | 106 | 17 | 60795379 | 60795402 | ENSG00000141376 | BCAS3 | transcript | 60677851 | 61392831 | + | protein_coding | ENST00000407086.8 | protein_coding | BCAS3-202 | ENSP00000385323.2 | NaN | NaN |
| 76 | 107 | 3 | 109427129 | 109427152 | ENSG00000228980 | LINC01205 | transcript | 109409990 | 109495167 | + | lncRNA | ENST00000497996.1 | lncRNA | LINC01205-202 | NaN | NaN | NaN |
| 77 | 108 | 2 | 19181429 | 19181452 | ENSG00000236204 | LINC01376 | transcript | 18986474 | 19348067 | - | lncRNA | ENST00000650025.1 | lncRNA | LINC01376-205 | NaN | NaN | NaN |
| 78 | 109 | 6 | 34252505 | 34252528 | ENSG00000225339 | ENSG00000225339 | transcript | 34248535 | 34284453 | + | lncRNA | ENST00000586726.3 | lncRNA | ENST00000586726 | NaN | NaN | NaN |
| 79 | 110 | 15 | 50174320 | 50174343 | ENSG00000104043 | ATP8B4 | transcript | 50047392 | 50182817 | - | protein_coding | ENST00000558829.1 | protein_coding | ATP8B4-207 | ENSP00000453539.1 | NaN | NaN |
| 80 | 112 | 2 | 230261415 | 230261438 | ENSG00000079263 | SP140 | transcript | 230225730 | 230313215 | + | protein_coding | ENST00000420434.7 | protein_coding | SP140-205 | ENSP00000398210.3 | NaN | NaN |
| 81 | 113 | 6 | 157392057 | 157392080 | ENSG00000175048 | ZDHHC14 | transcript | 157381133 | 157673945 | + | protein_coding | ENST00000414563.6 | protein_coding | ZDHHC14-204 | ENSP00000410713.2 | NaN | NaN |
| 82 | 114 | 15 | 23851496 | 23851519 | ENSG00000286973 | ENSG00000286973 | transcript | 23757115 | 23856375 | + | lncRNA | ENST00000658937.1 | lncRNA | ENST00000658937 | NaN | NaN | NaN |
| 83 | 115 | 10 | 21110550 | 21110573 | ENSG00000078114 | NEBL | transcript | 20780050 | 21293011 | - | protein_coding | ENST00000675702.1 | protein_coding_CDS_not_defined | NEBL-221 | NaN | NaN | NaN |
| 84 | 119 | 4 | 114944688 | 114944711 | ENSG00000138653 | NDST4 | transcript | 114827763 | 115113620 | - | protein_coding | ENST00000264363.7 | protein_coding | NDST4-201 | ENSP00000264363.2 | NaN | NaN |
| 85 | 124 | 16 | 71992820 | 71992843 | ENSG00000277481 | PKD1L3 | transcript | 71929538 | 72000402 | - | protein_coding | ENST00000620267.2 | protein_coding | PKD1L3-201 | ENSP00000480090.1 | NaN | NaN |
| 86 | 126 | 9 | 23172517 | 23172540 | ENSG00000284418 | ENSG00000284418 | transcript | 22703516 | 23438700 | - | lncRNA | ENST00000640003.1 | lncRNA | ENST00000640003 | NaN | NaN | NaN |
| 87 | 127 | 1 | 23909844 | 23909867 | ENSG00000188822 | CNR2 | transcript | 23870515 | 23913362 | - | protein_coding | ENST00000374472.5 | protein_coding | CNR2-201 | ENSP00000363596.4 | NaN | NaN |
| 88 | 131 | 5 | 44608016 | 44608039 | ENSG00000249203 | LINC02224 | transcript | 44495099 | 44658569 | - | lncRNA | ENST00000671607.1 | lncRNA | LINC02224-203 | NaN | NaN | NaN |
| 89 | 132 | 11 | 82968767 | 82968790 | ENSG00000254698 | ENSG00000254698 | transcript | 82963681 | 83039115 | - | lncRNA | ENST00000527550.1 | lncRNA | ENST00000527550 | NaN | NaN | NaN |
| 90 | 132 | 11 | 82968767 | 82968790 | ENSG00000137509 | PRCP | transcript | 82849914 | 82970584 | - | protein_coding | ENST00000534396.5 | protein_coding | PRCP-216 | ENSP00000432506.1 | NaN | NaN |
| 91 | 133 | 1 | 220067876 | 220067899 | ENSG00000162813 | BPNT1 | transcript | 220057482 | 220089853 | - | protein_coding | ENST00000544404.5 | protein_coding | BPNT1-210 | ENSP00000444398.1 | NaN | NaN |
| 92 | 134 | 7 | 106100043 | 106100066 | ENSG00000008282 | SYPL1 | transcript | 106090505 | 106112576 | - | protein_coding | ENST00000011473.6 | protein_coding | SYPL1-201 | ENSP00000011473.2 | NaN | NaN |
| 93 | 136 | 1 | 82986200 | 82986223 | ENSG00000236268 | LINC01361 | exon | 82986149 | 82986208 | - | lncRNA | ENST00000421931.1 | lncRNA | LINC01361-201 | NaN | 1.0 | ENSE00001661627.1 |
| 94 | 136 | 1 | 82986200 | 82986223 | ENSG00000230817 | LINC01362 | transcript | 82903183 | 83166815 | + | lncRNA | ENST00000452901.5 | lncRNA | LINC01362-202 | NaN | NaN | NaN |
| 95 | 137 | 4 | 66084287 | 66084310 | ENSG00000249413 | ENSG00000249413 | transcript | 65998846 | 66150012 | + | lncRNA | ENST00000508572.1 | lncRNA | ENST00000508572 | NaN | NaN | NaN |
| 96 | 140 | 3 | 62710675 | 62710698 | ENSG00000163618 | CADPS | transcript | 62398346 | 62875389 | - | protein_coding | ENST00000612439.4 | protein_coding | CADPS-219 | ENSP00000484365.1 | NaN | NaN |
| 97 | 141 | X | 6864115 | 6864138 | ENSG00000130021 | PUDP | gene | 6667865 | 7148158 | - | protein_coding | NaN | NaN | NaN | NaN | NaN | NaN |
| 98 | 142 | 12 | 40294380 | 40294403 | ENSG00000188906 | LRRK2 | transcript | 40224997 | 40369285 | + | protein_coding | ENST00000298910.12 | protein_coding | LRRK2-201 | ENSP00000298910.7 | NaN | NaN |
There are no Result for this database
| off_target_id | ot_chromosome | ot_start | ot_end | gene_ensembl_id | epd_gene_symbol | start | end | strand | remap | epd_coding | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 82 | 10 | 79560000 | 79560023 | ENSG00000185303 | SFTPA2_1 | 79559875 | 79560524 | - | FOS:CFPAC-1 | 1 |
| 1 | 82 | 10 | 79560000 | 79560023 | ENSG00000185303 | SFTPA2_1 | 79559881 | 79560709 | - | JUNB:CFPAC-1 | 1 |
| 2 | 82 | 10 | 79560000 | 79560023 | ENSG00000185303 | SFTPA2_1 | 79559996 | 79560583 | - | MED1:VCaP | 1 |
| off_target_id | ot_chromosome | ot_start | ot_end | gene_ensembl_id | gene_symbol | gene_start | enh_start | enh_stop | enhancer_gene_score | tissue | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 3 | 9 | 77194978 | 77195001 | ENSG00000232998 | RP11-470P4.2 | 79792910 | 77194494 | 77196074 | 1.289901 | HUVEC |
| 1 | 3 | 9 | 77194978 | 77195001 | ENSG00000197969 | VPS13A | 79792269 | 77194494 | 77196074 | 2.082406 | HUVEC |
| 2 | 24 | 2 | 70721232 | 70721255 | ENSG00000075340 | ADD2 | 70995357 | 70719578 | 70721908 | 2.707861 | Cerebellum |
| 3 | 24 | 2 | 70721232 | 70721255 | ENSG00000116035 | VAX2 | 71127720 | 70719578 | 70721908 | 0.962058 | Cerebellum |
| 4 | 24 | 2 | 70721232 | 70721255 | ENSG00000124357 | NAGK | 71291474 | 70719578 | 70721908 | 1.561114 | Cerebellum |
| 5 | 24 | 2 | 70721232 | 70721255 | ENSG00000231386 | AC007395.4 | 71038606 | 70719578 | 70721908 | 1.490075 | Cerebellum |
| 6 | 24 | 2 | 70721232 | 70721255 | ENSG00000237751 | AC007040.5 | 71115001 | 70719578 | 70721908 | 1.146756 | Cerebellum |
| 7 | 24 | 2 | 70721232 | 70721255 | ENSG00000152672 | CLEC4F | 71047732 | 70719578 | 70721908 | 0.701879 | Cerebellum |
| 8 | 33 | 18 | 8717824 | 8717847 | ENSG00000206418 | RAB12 | 8609443 | 8717422 | 8717902 | 2.839791 | Mesendoderm |
| 9 | 33 | 18 | 8717824 | 8717847 | ENSG00000206418 | RAB12 | 8609443 | 8717422 | 8717902 | 1.152515 | H9 |
| 10 | 33 | 18 | 8717824 | 8717847 | ENSG00000206418 | RAB12 | 8609443 | 8717422 | 8717902 | 1.152515 | Caco-2 |
| 11 | 33 | 18 | 8717824 | 8717847 | ENSG00000168502 | SOGA2 | 8706513 | 8717422 | 8717902 | 1.982582 | H1 |
| 12 | 33 | 18 | 8717824 | 8717847 | ENSG00000168502 | SOGA2 | 8706513 | 8717422 | 8717902 | 1.982582 | H9 |
| 13 | 33 | 18 | 8717824 | 8717847 | ENSG00000168502 | SOGA2 | 8706513 | 8717422 | 8717902 | 1.982582 | Caco-2 |
| 14 | 33 | 18 | 8717824 | 8717847 | ENSG00000101745 | ANKRD12 | 9136758 | 8717422 | 8717902 | 0.746762 | Mesendoderm |
| 15 | 33 | 18 | 8717824 | 8717847 | ENSG00000168502 | SOGA2 | 8706513 | 8717422 | 8717902 | 1.982582 | Mesendoderm |
| 16 | 33 | 18 | 8717824 | 8717847 | ENSG00000206418 | RAB12 | 8609443 | 8717422 | 8717902 | 0.975121 | H1 |
| 17 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | 39873280 | 39585559 | 39587339 | 2.770241 | VCaP |
| 18 | 46 | 15 | 39586806 | 39586829 | ENSG00000104081 | BMF | 40401093 | 39585559 | 39587339 | 2.471222 | HFF |
| 19 | 46 | 15 | 39586806 | 39586829 | ENSG00000128829 | EIF2AK4 | 40226347 | 39585559 | 39587339 | 1.090321 | T98G |
| 20 | 46 | 15 | 39586806 | 39586829 | ENSG00000128829 | EIF2AK4 | 40226347 | 39585559 | 39587339 | 1.314983 | MCF10A |
| 21 | 46 | 15 | 39586806 | 39586829 | ENSG00000128829 | EIF2AK4 | 40226347 | 39585559 | 39587339 | 1.463177 | Myotube |
| 22 | 46 | 15 | 39586806 | 39586829 | ENSG00000128829 | EIF2AK4 | 40226347 | 39585559 | 39587339 | 1.764227 | BJ |
| 23 | 46 | 15 | 39586806 | 39586829 | ENSG00000128829 | EIF2AK4 | 40226347 | 39585559 | 39587339 | 1.764227 | IMR90 |
| 24 | 46 | 15 | 39586806 | 39586829 | ENSG00000128829 | EIF2AK4 | 40226347 | 39585559 | 39587339 | 1.764227 | NHEK |
| 25 | 46 | 15 | 39586806 | 39586829 | ENSG00000128829 | EIF2AK4 | 40226347 | 39585559 | 39587339 | 2.866988 | HFF |
| 26 | 46 | 15 | 39586806 | 39586829 | ENSG00000128944 | C15orf23 | 40674922 | 39585559 | 39587339 | 1.388441 | HFF |
| 27 | 46 | 15 | 39586806 | 39586829 | ENSG00000246863 | RP11-325N19.3 | 40213243 | 39585559 | 39587339 | 1.059056 | NHEK |
| 28 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | 39873280 | 39585559 | 39587339 | 3.599908 | Myotube |
| 29 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | 39873280 | 39585559 | 39587339 | 3.177532 | MCF10A |
| 30 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | 39873280 | 39585559 | 39587339 | 3.361306 | HFF |
| 31 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | 39873280 | 39585559 | 39587339 | 3.412227 | T98G |
| 32 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | 39873280 | 39585559 | 39587339 | 3.486646 | NHLF |
| 33 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | 39873280 | 39585559 | 39587339 | 3.515456 | Astrocyte |
| 34 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | 39873280 | 39585559 | 39587339 | 3.599908 | IMR90 |
| 35 | 46 | 15 | 39586806 | 39586829 | ENSG00000104081 | BMF | 40401093 | 39585559 | 39587339 | 0.588085 | Myotube |
| 36 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | 39873280 | 39585559 | 39587339 | 3.599908 | NHEK |
| 37 | 46 | 15 | 39586806 | 39586829 | ENSG00000140319 | SRP14 | 40331389 | 39585559 | 39587339 | 1.935293 | MCF10A |
| 38 | 46 | 15 | 39586806 | 39586829 | ENSG00000140319 | SRP14 | 40331389 | 39585559 | 39587339 | 2.286523 | HFF |
| 39 | 46 | 15 | 39586806 | 39586829 | ENSG00000140320 | BAHD1 | 40731920 | 39585559 | 39587339 | 1.690666 | HFF |
| 40 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | 39873280 | 39585559 | 39587339 | 3.158810 | A549 |
| 41 | 46 | 15 | 39586806 | 39586829 | ENSG00000246863 | RP11-325N19.3 | 40213243 | 39585559 | 39587339 | 1.499990 | BJ |
| 42 | 46 | 15 | 39586806 | 39586829 | ENSG00000188549 | C15orf52 | 40633168 | 39585559 | 39587339 | 1.284527 | HFF |
| 43 | 46 | 15 | 39586806 | 39586829 | ENSG00000150667 | FSIP1 | 40075031 | 39585559 | 39587339 | 0.940266 | Astrocyte |
| 44 | 46 | 15 | 39586806 | 39586829 | ENSG00000156970 | BUB1B | 40453224 | 39585559 | 39587339 | 2.471222 | HFF |
| 45 | 46 | 15 | 39586806 | 39586829 | ENSG00000166073 | GPR176 | 40213093 | 39585559 | 39587339 | 1.616446 | IMR90 |
| 46 | 46 | 15 | 39586806 | 39586829 | ENSG00000166073 | GPR176 | 40213093 | 39585559 | 39587339 | 1.343758 | T98G |
| 47 | 46 | 15 | 39586806 | 39586829 | ENSG00000166073 | GPR176 | 40213093 | 39585559 | 39587339 | 1.265064 | MCF10A |
| 48 | 46 | 15 | 39586806 | 39586829 | ENSG00000166073 | GPR176 | 40213093 | 39585559 | 39587339 | 1.022059 | NHEK |
| 49 | 46 | 15 | 39586806 | 39586829 | ENSG00000156970 | BUB1B | 40453224 | 39585559 | 39587339 | 0.594131 | A549 |
| 50 | 46 | 15 | 39586806 | 39586829 | ENSG00000150667 | FSIP1 | 40075031 | 39585559 | 39587339 | 2.734578 | HFF |
| 51 | 46 | 15 | 39586806 | 39586829 | ENSG00000150667 | FSIP1 | 40075031 | 39585559 | 39587339 | 2.167931 | MCF10A |
| 52 | 46 | 15 | 39586806 | 39586829 | ENSG00000150667 | FSIP1 | 40075031 | 39585559 | 39587339 | 1.555013 | T98G |
| 53 | 46 | 15 | 39586806 | 39586829 | ENSG00000150667 | FSIP1 | 40075031 | 39585559 | 39587339 | 1.371077 | Myotube |
| 54 | 46 | 15 | 39586806 | 39586829 | ENSG00000166073 | GPR176 | 40213093 | 39585559 | 39587339 | 1.868260 | BJ |
| 55 | 46 | 15 | 39586806 | 39586829 | ENSG00000166073 | GPR176 | 40213093 | 39585559 | 39587339 | 1.764227 | Myotube |
| 56 | 46 | 15 | 39586806 | 39586829 | ENSG00000166073 | GPR176 | 40213093 | 39585559 | 39587339 | 3.001767 | HFF |
| 57 | 46 | 15 | 39586806 | 39586829 | ENSG00000166133 | RPUSD2 | 40861499 | 39585559 | 39587339 | 0.910406 | HFF |
| 58 | 46 | 15 | 39586806 | 39586829 | ENSG00000175746 | C15orf54 | 39542885 | 39585559 | 39587339 | 1.137619 | HFF |
| 59 | 46 | 15 | 39586806 | 39586829 | ENSG00000175746 | C15orf54 | 39542885 | 39585559 | 39587339 | 1.244403 | IMR90 |
| 60 | 46 | 15 | 39586806 | 39586829 | ENSG00000175746 | C15orf54 | 39542885 | 39585559 | 39587339 | 1.980771 | Myotube |
| 61 | 46 | 15 | 39586806 | 39586829 | ENSG00000175746 | C15orf54 | 39542885 | 39585559 | 39587339 | 2.058603 | BJ |
| 62 | 46 | 15 | 39586806 | 39586829 | ENSG00000150667 | FSIP1 | 40075031 | 39585559 | 39587339 | 0.741502 | IMR90 |
| 63 | 46 | 15 | 39586806 | 39586829 | ENSG00000238564 | snoU13 | 40242907 | 39585559 | 39587339 | 1.352899 | BJ |
| 64 | 46 | 15 | 39586806 | 39586829 | ENSG00000244251 | RP11-64K12.1 | 40773514 | 39585559 | 39587339 | 1.671009 | HFF |
| 65 | 46 | 15 | 39586806 | 39586829 | ENSG00000244705 | RP11-133K1.1 | 40605490 | 39585559 | 39587339 | 0.569207 | HFF |
| 66 | 46 | 15 | 39586806 | 39586829 | ENSG00000246863 | RP11-325N19.3 | 40213243 | 39585559 | 39587339 | 1.059056 | Myotube |
| 67 | 46 | 15 | 39586806 | 39586829 | ENSG00000150667 | FSIP1 | 40075031 | 39585559 | 39587339 | 1.222791 | NHEK |
| 68 | 46 | 15 | 39586806 | 39586829 | ENSG00000137801 | THBS1 | 39873280 | 39585559 | 39587339 | 3.039391 | Hela-S3 |
| 69 | 46 | 15 | 39586806 | 39586829 | ENSG00000246863 | RP11-325N19.3 | 40213243 | 39585559 | 39587339 | 0.677107 | T98G |
| 70 | 46 | 15 | 39586806 | 39586829 | ENSG00000259432 | RP11-37C7.2 | 40107630 | 39585559 | 39587339 | 1.389419 | T98G |
| 71 | 46 | 15 | 39586806 | 39586829 | ENSG00000259269 | RP11-624L4.2 | 39764904 | 39585559 | 39587339 | 0.734527 | NHEK |
| 72 | 46 | 15 | 39586806 | 39586829 | ENSG00000259269 | RP11-624L4.2 | 39764904 | 39585559 | 39587339 | 2.400089 | HFF |
| 73 | 46 | 15 | 39586806 | 39586829 | ENSG00000259279 | CTD-2033D15.1 | 39886432 | 39585559 | 39587339 | 1.777548 | Hela-S3 |
| 74 | 46 | 15 | 39586806 | 39586829 | ENSG00000259279 | CTD-2033D15.1 | 39886432 | 39585559 | 39587339 | 1.801157 | NHLF |
| 75 | 46 | 15 | 39586806 | 39586829 | ENSG00000259279 | CTD-2033D15.1 | 39886432 | 39585559 | 39587339 | 1.965065 | A549 |
| 76 | 46 | 15 | 39586806 | 39586829 | ENSG00000259279 | CTD-2033D15.1 | 39886432 | 39585559 | 39587339 | 2.579275 | Astrocyte |
| 77 | 46 | 15 | 39586806 | 39586829 | ENSG00000259279 | CTD-2033D15.1 | 39886432 | 39585559 | 39587339 | 3.097898 | MCF10A |
| 78 | 46 | 15 | 39586806 | 39586829 | ENSG00000259279 | CTD-2033D15.1 | 39886432 | 39585559 | 39587339 | 3.158810 | HFF |
| 79 | 46 | 15 | 39586806 | 39586829 | ENSG00000259279 | CTD-2033D15.1 | 39886432 | 39585559 | 39587339 | 3.233230 | VCaP |
| 80 | 46 | 15 | 39586806 | 39586829 | ENSG00000259279 | CTD-2033D15.1 | 39886432 | 39585559 | 39587339 | 3.272073 | T98G |
| 81 | 46 | 15 | 39586806 | 39586829 | ENSG00000259389 | RP11-325N19.2 | 40243909 | 39585559 | 39587339 | 1.830373 | BJ |
| 82 | 46 | 15 | 39586806 | 39586829 | ENSG00000259389 | RP11-325N19.2 | 40243909 | 39585559 | 39587339 | 1.829363 | Myotube |
| 83 | 46 | 15 | 39586806 | 39586829 | ENSG00000259389 | RP11-325N19.2 | 40243909 | 39585559 | 39587339 | 1.418177 | T98G |
| 84 | 46 | 15 | 39586806 | 39586829 | ENSG00000259345 | RP11-624L4.1 | 39719396 | 39585559 | 39587339 | 3.168408 | HFF |
| 85 | 46 | 15 | 39586806 | 39586829 | ENSG00000259345 | RP11-624L4.1 | 39719396 | 39585559 | 39587339 | 1.220743 | IMR90 |
| 86 | 46 | 15 | 39586806 | 39586829 | ENSG00000259345 | RP11-624L4.1 | 39719396 | 39585559 | 39587339 | 1.207043 | T98G |
| 87 | 46 | 15 | 39586806 | 39586829 | ENSG00000259345 | RP11-624L4.1 | 39719396 | 39585559 | 39587339 | 1.071054 | MCF10A |
| 88 | 46 | 15 | 39586806 | 39586829 | ENSG00000259345 | RP11-624L4.1 | 39719396 | 39585559 | 39587339 | 0.846798 | Myotube |
| 89 | 46 | 15 | 39586806 | 39586829 | ENSG00000259345 | RP11-624L4.1 | 39719396 | 39585559 | 39587339 | 0.529754 | NHLF |
| 90 | 46 | 15 | 39586806 | 39586829 | ENSG00000259279 | CTD-2033D15.1 | 39886432 | 39585559 | 39587339 | 3.405850 | Myotube |
| 91 | 46 | 15 | 39586806 | 39586829 | ENSG00000259279 | CTD-2033D15.1 | 39886432 | 39585559 | 39587339 | 3.369437 | NHEK |
| 92 | 46 | 15 | 39586806 | 39586829 | ENSG00000259279 | CTD-2033D15.1 | 39886432 | 39585559 | 39587339 | 3.300719 | IMR90 |
| 93 | 46 | 15 | 39586806 | 39586829 | ENSG00000259432 | RP11-37C7.2 | 40107630 | 39585559 | 39587339 | 1.245299 | NHEK |
| 94 | 46 | 15 | 39586806 | 39586829 | ENSG00000259269 | RP11-624L4.2 | 39764904 | 39585559 | 39587339 | 0.557133 | NHLF |
| 95 | 46 | 15 | 39586806 | 39586829 | ENSG00000248508 | RP11-521C20.4 | 40331512 | 39585559 | 39587339 | 2.471222 | HFF |
| 96 | 46 | 15 | 39586806 | 39586829 | ENSG00000259345 | RP11-624L4.1 | 39719396 | 39585559 | 39587339 | 0.699017 | NHEK |
| 97 | 46 | 15 | 39586806 | 39586829 | ENSG00000259580 | RP11-37C7.1 | 40093534 | 39585559 | 39587339 | 1.371077 | BJ |
| 98 | 46 | 15 | 39586806 | 39586829 | ENSG00000259432 | RP11-37C7.2 | 40107630 | 39585559 | 39587339 | 1.508839 | BJ |
| 99 | 46 | 15 | 39586806 | 39586829 | ENSG00000246863 | RP11-325N19.3 | 40213243 | 39585559 | 39587339 | 1.644068 | HFF |
| 100 | 46 | 15 | 39586806 | 39586829 | ENSG00000259432 | RP11-37C7.2 | 40107630 | 39585559 | 39587339 | 1.508839 | IMR90 |
| 101 | 46 | 15 | 39586806 | 39586829 | ENSG00000259432 | RP11-37C7.2 | 40107630 | 39585559 | 39587339 | 1.508839 | Myotube |
| 102 | 46 | 15 | 39586806 | 39586829 | ENSG00000259450 | RP11-265N7.1 | 39486510 | 39585559 | 39587339 | 1.945748 | Myotube |
| 103 | 46 | 15 | 39586806 | 39586829 | ENSG00000259450 | RP11-265N7.1 | 39486510 | 39585559 | 39587339 | 2.702061 | HFF |
| 104 | 46 | 15 | 39586806 | 39586829 | ENSG00000259536 | RP11-111A22.1 | 40780240 | 39585559 | 39587339 | 0.978875 | HFF |
| 105 | 46 | 15 | 39586806 | 39586829 | ENSG00000259580 | RP11-37C7.1 | 40093534 | 39585559 | 39587339 | 0.741502 | Myotube |
| 106 | 46 | 15 | 39586806 | 39586829 | ENSG00000259580 | RP11-37C7.1 | 40093534 | 39585559 | 39587339 | 0.779012 | NHEK |
| 107 | 46 | 15 | 39586806 | 39586829 | ENSG00000259580 | RP11-37C7.1 | 40093534 | 39585559 | 39587339 | 1.222791 | IMR90 |
| 108 | 46 | 15 | 39586806 | 39586829 | ENSG00000259409 | RP11-521C20.3 | 40381033 | 39585559 | 39587339 | 1.369498 | HFF |
| 109 | 46 | 15 | 39586806 | 39586829 | ENSG00000259580 | RP11-37C7.1 | 40093534 | 39585559 | 39587339 | 1.671365 | T98G |
| 110 | 46 | 15 | 39586806 | 39586829 | ENSG00000259447 | RP11-462P6.1 | 39602983 | 39585559 | 39587339 | 0.678879 | BJ |
| 111 | 46 | 15 | 39586806 | 39586829 | ENSG00000259580 | RP11-37C7.1 | 40093534 | 39585559 | 39587339 | 2.324861 | HFF |
| 112 | 46 | 15 | 39586806 | 39586829 | ENSG00000261136 | RP11-37C7.3 | 40074772 | 39585559 | 39587339 | 2.734578 | HFF |
| 113 | 46 | 15 | 39586806 | 39586829 | ENSG00000259580 | RP11-37C7.1 | 40093534 | 39585559 | 39587339 | 1.896027 | MCF10A |
| 114 | 46 | 15 | 39586806 | 39586829 | ENSG00000261136 | RP11-37C7.3 | 40074772 | 39585559 | 39587339 | 2.352518 | IMR90 |
| 115 | 46 | 15 | 39586806 | 39586829 | ENSG00000261136 | RP11-37C7.3 | 40074772 | 39585559 | 39587339 | 1.904391 | MCF10A |
| 116 | 46 | 15 | 39586806 | 39586829 | ENSG00000261136 | RP11-37C7.3 | 40074772 | 39585559 | 39587339 | 2.088979 | NHEK |
| 117 | 46 | 15 | 39586806 | 39586829 | ENSG00000261136 | RP11-37C7.3 | 40074772 | 39585559 | 39587339 | 1.658168 | Astrocyte |
| 118 | 46 | 15 | 39586806 | 39586829 | ENSG00000261136 | RP11-37C7.3 | 40074772 | 39585559 | 39587339 | 1.378504 | NHLF |
| 119 | 46 | 15 | 39586806 | 39586829 | ENSG00000261136 | RP11-37C7.3 | 40074772 | 39585559 | 39587339 | 1.370315 | T98G |
| 120 | 46 | 15 | 39586806 | 39586829 | ENSG00000259584 | RP11-521C20.2 | 40370905 | 39585559 | 39587339 | 1.557663 | HFF |
| 121 | 46 | 15 | 39586806 | 39586829 | ENSG00000261136 | RP11-37C7.3 | 40074772 | 39585559 | 39587339 | 1.689895 | BJ |
| 122 | 46 | 15 | 39586806 | 39586829 | ENSG00000261136 | RP11-37C7.3 | 40074772 | 39585559 | 39587339 | 2.352518 | Myotube |
| 123 | 80 | 2 | 63889184 | 63889207 | ENSG00000251775 | ACA59 | 64110525 | 63887646 | 63890076 | 2.152890 | HepG2 |
| 124 | 80 | 2 | 63889184 | 63889207 | ENSG00000251775 | ACA59 | 64110525 | 63887646 | 63890076 | 2.152890 | H1 |
| 125 | 80 | 2 | 63889184 | 63889207 | ENSG00000228872 | AC096664.2 | 63944256 | 63887646 | 63890076 | 0.967266 | Skeletal_muscle |
| 126 | 80 | 2 | 63889184 | 63889207 | ENSG00000197329 | PELI1 | 64371588 | 63887646 | 63890076 | 1.641154 | H1 |
| 127 | 80 | 2 | 63889184 | 63889207 | ENSG00000225889 | AC074289.1 | 64370373 | 63887646 | 63890076 | 1.055426 | H1 |
| 128 | 80 | 2 | 63889184 | 63889207 | ENSG00000228079 | AC012368.1 | 64315380 | 63887646 | 63890076 | 1.103740 | HUVEC |
| 129 | 80 | 2 | 63889184 | 63889207 | ENSG00000228079 | AC012368.1 | 64315380 | 63887646 | 63890076 | 1.532574 | H1 |
| 130 | 80 | 2 | 63889184 | 63889207 | ENSG00000228872 | AC096664.2 | 63944256 | 63887646 | 63890076 | 0.802053 | HUVEC |
| 131 | 80 | 2 | 63889184 | 63889207 | ENSG00000234488 | AC096664.1 | 63911439 | 63887646 | 63890076 | 0.895399 | A549 |
| 132 | 80 | 2 | 63889184 | 63889207 | ENSG00000228872 | AC096664.2 | 63944256 | 63887646 | 63890076 | 1.151964 | HepG2 |
| 133 | 80 | 2 | 63889184 | 63889207 | ENSG00000228872 | AC096664.2 | 63944256 | 63887646 | 63890076 | 1.257095 | K562 |
| 134 | 80 | 2 | 63889184 | 63889207 | ENSG00000234488 | AC096664.1 | 63911439 | 63887646 | 63890076 | 0.815832 | H1 |
| 135 | 80 | 2 | 63889184 | 63889207 | ENSG00000234488 | AC096664.1 | 63911439 | 63887646 | 63890076 | 0.895399 | Skeletal_muscle |
| 136 | 80 | 2 | 63889184 | 63889207 | ENSG00000234488 | AC096664.1 | 63911439 | 63887646 | 63890076 | 1.000530 | GM12891 |
| 137 | 80 | 2 | 63889184 | 63889207 | ENSG00000234488 | AC096664.1 | 63911439 | 63887646 | 63890076 | 1.095033 | HepG2 |
| 138 | 80 | 2 | 63889184 | 63889207 | ENSG00000234488 | AC096664.1 | 63911439 | 63887646 | 63890076 | 1.095033 | K562 |
| 139 | 80 | 2 | 63889184 | 63889207 | ENSG00000251775 | ACA59 | 64110525 | 63887646 | 63890076 | 2.152890 | Skeletal_muscle |
| 140 | 80 | 2 | 63889184 | 63889207 | ENSG00000234488 | AC096664.1 | 63911439 | 63887646 | 63890076 | 1.543734 | HUVEC |
| 141 | 80 | 2 | 63889184 | 63889207 | ENSG00000228872 | AC096664.2 | 63944256 | 63887646 | 63890076 | 1.151964 | H1 |
| 142 | 80 | 2 | 63889184 | 63889207 | ENSG00000143952 | VPS54 | 64246567 | 63887646 | 63890076 | 1.048327 | A549 |
| 143 | 80 | 2 | 63889184 | 63889207 | ENSG00000143951 | WDPCP | 64054977 | 63887646 | 63890076 | 0.852275 | GM12891 |
| 144 | 80 | 2 | 63889184 | 63889207 | ENSG00000197329 | PELI1 | 64371588 | 63887646 | 63890076 | 0.996023 | HUVEC |
| 145 | 80 | 2 | 63889184 | 63889207 | ENSG00000251775 | ACA59 | 64110525 | 63887646 | 63890076 | 2.152890 | A549 |
| 146 | 80 | 2 | 63889184 | 63889207 | ENSG00000169764 | UGP2 | 64068074 | 63887646 | 63890076 | 1.706119 | Skeletal_muscle |
| 147 | 80 | 2 | 63889184 | 63889207 | ENSG00000169764 | UGP2 | 64068074 | 63887646 | 63890076 | 1.706119 | K562 |
| 148 | 80 | 2 | 63889184 | 63889207 | ENSG00000169764 | UGP2 | 64068074 | 63887646 | 63890076 | 1.706119 | HepG2 |
| 149 | 80 | 2 | 63889184 | 63889207 | ENSG00000169764 | UGP2 | 64068074 | 63887646 | 63890076 | 1.706119 | H1 |
| 150 | 80 | 2 | 63889184 | 63889207 | ENSG00000169764 | UGP2 | 64068074 | 63887646 | 63890076 | 1.706119 | GM12891 |
| 151 | 80 | 2 | 63889184 | 63889207 | ENSG00000169764 | UGP2 | 64068074 | 63887646 | 63890076 | 1.706119 | A549 |
| 152 | 80 | 2 | 63889184 | 63889207 | ENSG00000143952 | VPS54 | 64246567 | 63887646 | 63890076 | 2.023337 | H1 |
| 153 | 80 | 2 | 63889184 | 63889207 | ENSG00000143952 | VPS54 | 64246567 | 63887646 | 63890076 | 1.526771 | HepG2 |
| 154 | 80 | 2 | 63889184 | 63889207 | ENSG00000143952 | VPS54 | 64246567 | 63887646 | 63890076 | 1.330964 | HUVEC |
| 155 | 80 | 2 | 63889184 | 63889207 | ENSG00000143952 | VPS54 | 64246567 | 63887646 | 63890076 | 0.505124 | Skeletal_muscle |
| 156 | 80 | 2 | 63889184 | 63889207 | ENSG00000143952 | VPS54 | 64246567 | 63887646 | 63890076 | 0.505124 | K562 |
| 157 | 80 | 2 | 63889184 | 63889207 | ENSG00000143952 | VPS54 | 64246567 | 63887646 | 63890076 | 0.505124 | GM12891 |
| 158 | 80 | 2 | 63889184 | 63889207 | ENSG00000143951 | WDPCP | 64054977 | 63887646 | 63890076 | 1.836682 | HUVEC |
| 159 | 80 | 2 | 63889184 | 63889207 | ENSG00000143951 | WDPCP | 64054977 | 63887646 | 63890076 | 1.145193 | Skeletal_muscle |
| 160 | 80 | 2 | 63889184 | 63889207 | ENSG00000143951 | WDPCP | 64054977 | 63887646 | 63890076 | 1.145193 | H1 |
| 161 | 80 | 2 | 63889184 | 63889207 | ENSG00000143951 | WDPCP | 64054977 | 63887646 | 63890076 | 1.145193 | A549 |
| 162 | 80 | 2 | 63889184 | 63889207 | ENSG00000143951 | WDPCP | 64054977 | 63887646 | 63890076 | 1.036973 | HepG2 |
| 163 | 80 | 2 | 63889184 | 63889207 | ENSG00000143951 | WDPCP | 64054977 | 63887646 | 63890076 | 0.852275 | K562 |
| 164 | 80 | 2 | 63889184 | 63889207 | ENSG00000169764 | UGP2 | 64068074 | 63887646 | 63890076 | 2.251977 | HUVEC |
| 165 | 80 | 2 | 63889184 | 63889207 | ENSG00000251775 | ACA59 | 64110525 | 63887646 | 63890076 | 2.152890 | GM12891 |
| 166 | 100 | 19 | 39332965 | 39332988 | ENSG00000176401 | EID2B | 40023494 | 39330710 | 39333070 | 1.333203 | CD34+ |
| 167 | 100 | 19 | 39332965 | 39332988 | ENSG00000105197 | TIMM50 | 39971052 | 39330710 | 39333070 | 1.186866 | CD34+ |
| 168 | 100 | 19 | 39332965 | 39332988 | ENSG00000105205 | CLC | 40228668 | 39330710 | 39333070 | 0.818629 | CD34+ |
| 169 | 100 | 19 | 39332965 | 39332988 | ENSG00000128626 | MRPS12 | 39421348 | 39330710 | 39333070 | 0.794129 | CD34+ |
| 170 | 100 | 19 | 39332965 | 39332988 | ENSG00000130755 | GMFG | 39826726 | 39330710 | 39333070 | 2.706155 | CD34+ |
| 171 | 100 | 19 | 39332965 | 39332988 | ENSG00000176396 | EID2 | 40030870 | 39330710 | 39333070 | 1.027734 | CD34+ |
| 172 | 100 | 19 | 39332965 | 39332988 | ENSG00000179134 | SAMD4B | 39833108 | 39330710 | 39333070 | 1.825022 | CD34+ |
| 173 | 100 | 19 | 39332965 | 39332988 | ENSG00000213922 | AC011500.1 | 39930212 | 39330710 | 39333070 | 0.573034 | CD34+ |
| 174 | 100 | 19 | 39332965 | 39332988 | ENSG00000196235 | SUPT5H | 39936186 | 39330710 | 39333070 | 2.132557 | CD34+ |
| 175 | 100 | 19 | 39332965 | 39332988 | ENSG00000241983 | AC005239.1 | 39859790 | 39330710 | 39333070 | 2.772069 | CD34+ |
| 176 | 100 | 19 | 39332965 | 39332988 | ENSG00000006712 | PAF1 | 39881757 | 39330710 | 39333070 | 2.031669 | CD34+ |
| 177 | 100 | 19 | 39332965 | 39332988 | ENSG00000063322 | MED29 | 39881963 | 39330710 | 39333070 | 1.422884 | CD34+ |
| 178 | 100 | 19 | 39332965 | 39332988 | ENSG00000090924 | PLEKHG2 | 39903225 | 39330710 | 39333070 | 1.047092 | CD34+ |
| 179 | 100 | 19 | 39332965 | 39332988 | ENSG00000128016 | ZFP36 | 39897487 | 39330710 | 39333070 | 0.896815 | CD34+ |
| 180 | 100 | 19 | 39332965 | 39332988 | ENSG00000104823 | ECH1 | 39322497 | 39330710 | 39333070 | 0.513455 | CD34+ |
| 181 | 100 | 19 | 39332965 | 39332988 | ENSG00000105193 | RPS16 | 39926618 | 39330710 | 39333070 | 1.463711 | CD34+ |
| 182 | 100 | 19 | 39332965 | 39332988 | ENSG00000128011 | LRFN1 | 39805976 | 39330710 | 39333070 | 0.824896 | CD34+ |
| 183 | 115 | 10 | 21110550 | 21110573 | ENSG00000204683 | C10orf113 | 21435488 | 21109631 | 21111221 | 1.352665 | A549 |
| 184 | 115 | 10 | 21110550 | 21110573 | ENSG00000228860 | RP11-565H13.3 | 21506820 | 21109631 | 21111221 | 0.517181 | A549 |
| 185 | 115 | 10 | 21110550 | 21110573 | ENSG00000078114 | NEBL | 21463116 | 21109631 | 21111221 | 1.688397 | A549 |
| 186 | 115 | 10 | 21110550 | 21110573 | ENSG00000231920 | RP11-565H13.2 | 21462943 | 21109631 | 21111221 | 1.490428 | A549 |
| 187 | 125 | 11 | 118872252 | 118872275 | ENSG00000118096 | IFT46 | 118443685 | 118872011 | 118873991 | 1.561114 | GM19239 |
| 188 | 125 | 11 | 118872252 | 118872275 | ENSG00000110395 | CBL | 119076752 | 118872011 | 118873991 | 0.988160 | GM19239 |
| 189 | 125 | 11 | 118872252 | 118872275 | ENSG00000095139 | ARCN1 | 118443105 | 118872011 | 118873991 | 2.220670 | GM19239 |
| 190 | 125 | 11 | 118872252 | 118872275 | ENSG00000160703 | NLRX1 | 119037277 | 118872011 | 118873991 | 0.684804 | GM19239 |
| 191 | 125 | 11 | 118872252 | 118872275 | ENSG00000188486 | H2AFX | 118966177 | 118872011 | 118873991 | 1.964105 | GM19239 |
| 192 | 125 | 11 | 118872252 | 118872275 | ENSG00000196655 | TRAPPC4 | 118889142 | 118872011 | 118873991 | 1.647715 | GM19239 |
| 193 | 125 | 11 | 118872252 | 118872275 | ENSG00000256269 | HMBS | 118955576 | 118872011 | 118873991 | 1.304549 | GM19239 |
| 194 | 125 | 11 | 118872252 | 118872275 | ENSG00000149582 | TMEM25 | 118401756 | 118872011 | 118873991 | 0.988160 | GM19239 |
| 195 | 125 | 11 | 118872252 | 118872275 | ENSG00000172269 | DPAGT1 | 118979041 | 118872011 | 118873991 | 1.304549 | GM19239 |
| 196 | 125 | 11 | 118872252 | 118872275 | ENSG00000172273 | HINFP | 118992297 | 118872011 | 118873991 | 1.529057 | GM19239 |
| 197 | 125 | 11 | 118872252 | 118872275 | ENSG00000118181 | RPS25 | 118889401 | 118872011 | 118873991 | 1.948765 | GM19239 |
| 198 | 125 | 11 | 118872252 | 118872275 | ENSG00000172375 | C2CD2L | 118972908 | 118872011 | 118873991 | 1.223297 | GM19239 |
There are no Result for this database
There are no Result for this database
| off_target_id | gene_ensembl_id | gene_symbol | omim_id | disease_related | inheritance_model | |
|---|---|---|---|---|---|---|
| 0 | 1 | ENSG00000107485 | GATA3 | 131320 | Hypoparathyroidism, sensorineural deafness, and renal dysplasia, 146255 (3) | Autosomal dominant |
| 1 | 142 | ENSG00000188906 | LRRK2 | 609007 | {Parkinson disease 8}, 607060 (3) | Autosomal dominant |
| 2 | 16 | ENSG00000159216 | RUNX1 | 151385 | Platelet disorder, familial, with associated myeloid malignancy, 601399 (3), ; Leukemia, acute myeloid, 601626 (3), Somatic mutation | Autosomal dominant |
| 3 | 27 | ENSG00000101333 | PLCB4 | 600810 | Auriculocondylar syndrome 2, 614669 (3) | Autosomal dominant Autosomal recessive |
| 4 | 3 | ENSG00000197969 | VPS13A | 605978 | Choreoacanthocytosis, 200150 (3) | Autosomal recessive |
| 5 | 31 | ENSG00000140464 | PML | 102578 | Leukemia, acute promyelocytic, PML/RARA type (3) | NaN |
| 6 | 4 | ENSG00000183638 | RP1L1 | 608581 | Retinitis pigmentosa 88, 618826 (3), ; Occult macular dystrophy, 613587 (3) | Autosomal dominant Autosomal recessive |
| 7 | 63 | ENSG00000100412 | ACO2 | 100850 | Infantile cerebellar-retinal degeneration, 614559 (3), ; ?Optic atrophy 9, 616289 (3) | Autosomal recessive |
| 8 | 68 | ENSG00000079482 | OPHN1 | 300127 | Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486 (3) | X-linked recessive |
| 9 | 69 | ENSG00000019991 | HGF | 142409 | Deafness, autosomal recessive 39, 608265 (3) | Autosomal recessive |
| 10 | 75 | ENSG00000135821 | GLUL | 138290 | Glutamine deficiency, congenital, 610015 (3) | Autosomal recessive |
| 11 | 80 | ENSG00000169764 | UGP2 | 191760 | Developmental and epileptic encephalopathy 83, 618744 (3) | Autosomal recessive |
| 12 | 82 | ENSG00000185303 | SFTPA2 | 178642 | Pulmonary fibrosis, idiopathic, 178500 (3) | Autosomal dominant |
| 13 | 83 | ENSG00000164619 | BMPER | 608699 | Diaphanospondylodysostosis, 608022 (3) | Autosomal recessive |
| 14 | 87 | ENSG00000147408 | CSGALNACT1 | 616615 | Skeletal dysplasia, mild, with joint laxity and advanced bone age, 618870 (3) | Autosomal recessive |
| 15 | 91 | ENSG00000155719 | OTOA | 607038 | Deafness, autosomal recessive 22, 607039 (3) | Autosomal recessive |
| 16 | 94 | ENSG00000183230 | CTNNA3 | 607667 | Arrhythmogenic right ventricular dysplasia, familial, 13, 615616 (3) | Autosomal dominant |
| off_target_id | gene_ensembl_id | gene_symbol | Family | HumanTF_source | |
|---|---|---|---|---|---|
| 0 | 1 | ENSG00000107485 | GATA3 | zf-GATA | TF |
| 1 | 106 | ENSG00000141376 | BCAS3 | Others | TF cofactors |
| 2 | 112 | ENSG00000079263 | SP140 | SAND | TF |
| 3 | 142 | ENSG00000188906 | LRRK2 | Other_CRF | TF cofactors |
| 4 | 16 | ENSG00000159216 | RUNX1 | Runt | TF |
| 5 | 31 | ENSG00000140464 | PML | Others | TF cofactors |
| gene_ensembl_id | gene_symbol | adipose tissue adipocytes | adrenal gland cells in zona fasciculata | adrenal gland cells in zona glomerulosa | adrenal gland cells in zona reticularis | adrenal gland glandular cells | adrenal gland medullary cells | appendix endocrine cells | appendix enterocytes | appendix enterocytes - Microvilli | appendix germinal center cells | appendix glandular cells | appendix goblet cells | appendix lymphoid tissue | appendix non-germinal center cells | bone marrow hematopoietic cells | breast adipocytes | breast glandular cells | breast myoepithelial cells | bronchus basal cells | bronchus ciliated cells (cell body) | bronchus ciliated cells (cilia axoneme) | bronchus ciliated cells (ciliary rootlets) | bronchus ciliated cells (tip of cilia) | bronchus goblet cells | bronchus respiratory epithelial cells | caudate glial cells | caudate neuronal cells | cerebellum Bergmann glia - cytoplasm/membrane | cerebellum Bergmann glia - nucleus | cerebellum GLUC cells - cytoplasm/membrane | cerebellum GLUC cells - nucleus | cerebellum Purkinje cells | cerebellum Purkinje cells - cytoplasm/membrane | cerebellum Purkinje cells - dendrites | cerebellum Purkinje cells - nucleus | cerebellum cells in granular layer | cerebellum cells in molecular layer | cerebellum granular cells - cytoplasm/membrane | cerebellum granular cells - nucleus | cerebellum molecular layer - neuropil | cerebellum molecular layer cells - cytoplasm/membrane | cerebellum molecular layer cells - nucleus | cerebellum processes in granular layer | cerebellum processes in molecular layer | cerebellum processes in white matter | cerebellum synaptic glomeruli - capsule | cerebellum synaptic glomeruli - core | cerebellum white matter cells - cytoplasm/membrane | cerebellum white matter cells - nucleus | cerebral cortex endothelial cells | cerebral cortex glial cells | cerebral cortex neuronal cells | cerebral cortex neuronal projections | cerebral cortex neuropil | cerebral cortex synapses | cervix glandular cells | cervix squamous epithelial cells | colon endocrine cells | colon endothelial cells | colon enterocytes | colon enterocytes - Microvilli | colon fibroblasts | colon glandular cells | colon goblet cells | colon mucosal lymphoid cells | colon peripheral nerve/ganglion | duodenum endocrine cells | duodenum enterocytes | duodenum enterocytes - Gradient | duodenum enterocytes - Microvilli | duodenum glands of Brunner | duodenum glandular cells | duodenum goblet cells | duodenum paneth cells | endometrium 1 cells in endometrial stroma | endometrium 1 glandular cells | endometrium 2 cells in endometrial stroma | endometrium 2 glandular cells | epididymis glandular cells | esophagus squamous epithelial cells | fallopian tube ciliated cells (cell body) | fallopian tube ciliated cells (cilia axoneme) | fallopian tube ciliated cells (ciliary rootlets) | fallopian tube ciliated cells (tip of cilia) | fallopian tube glandular cells | fallopian tube non-ciliated cells | gallbladder glandular cells | heart muscle cardiomyocytes | hippocampus glial cells | hippocampus neuronal cells | kidney bowman's capsule | kidney cells in glomeruli | kidney cells in tubules | kidney collecting ducts | kidney distal tubules | kidney proximal tubules (cell body) | kidney proximal tubules (microvilli) | liver cholangiocytes | liver hepatocytes | lung alveolar cells | lung alveolar cells type I | lung alveolar cells type II | lung endothelial cells | lung macrophages | lymph node germinal center cells | lymph node non-germinal center cells | nasopharynx basal cells | nasopharynx ciliated cells (cell body) | nasopharynx ciliated cells (cilia axoneme) | nasopharynx ciliated cells (ciliary rootlets) | nasopharynx ciliated cells (tip of cilia) | nasopharynx goblet cells | nasopharynx respiratory epithelial cells | oral mucosa squamous epithelial cells | ovary follicle cells | ovary ovarian stroma cells | pancreas exocrine glandular cells | pancreas pancreatic endocrine cells | parathyroid gland glandular cells | pituitary gland cells in anterior | placenta cytotrophoblasts | placenta decidual cells | placenta endothelial cells | placenta hofbauer cells | placenta syncytiotrophoblasts - cell body | placenta syncytiotrophoblasts - microvilli | placenta trophoblastic cells | prostate glandular cells | rectum endocrine cells | rectum endothelial cells | rectum enterocytes | rectum enterocytes - Microvilli | rectum fibroblasts | rectum glandular cells | rectum goblet cells | rectum mucosal lymphoid cells | rectum peripheral nerve/ganglion | retina ganglion cells | retina inner nuclear layer | retina inner plexiform layer | retina limiting membrane | retina nerve fiber layer | retina outer plexiform layer | retina photoreceptor cells | retina pigment epithelial cells | salivary gland glandular cells | seminal vesicle glandular cells | skeletal muscle myocytes | skin 1 Langerhans | skin 1 arrector pili muscle cells | skin 1 cells in basal layer | skin 1 cells in corneal layer | skin 1 cells in granular layer | skin 1 cells in spinous layer | skin 1 eccrine glands | skin 1 endothelial cells | skin 1 extracellular matrix | skin 1 fibroblasts | skin 1 fibrohistiocytic cells | skin 1 hair follicles | skin 1 keratinocytes | skin 1 langerhans cells | skin 1 lymphocytes | skin 1 melanocytes | skin 1 sebaceous glands | skin 1 vascular mural cells | skin 2 arrector pili muscle cells | skin 2 cells in basal layer | skin 2 cells in corneal layer | skin 2 cells in granular layer | skin 2 cells in spinous layer | skin 2 eccrine glands | skin 2 endothelial cells | skin 2 epidermal cells | skin 2 extracellular matrix | skin 2 fibrohistiocytic cells | skin 2 hair follicles | skin 2 langerhans cells | skin 2 lymphocytes | skin 2 melanocytes | skin 2 sebaceous glands | skin 2 vascular mural cells | small intestine endocrine cells | small intestine enterocytes | small intestine enterocytes - Gradient | small intestine enterocytes - Microvilli | small intestine glandular cells | small intestine goblet cells | small intestine paneth cells | smooth muscle smooth muscle cells | soft tissue 1 chondrocytes | soft tissue 1 fibroblasts | soft tissue 1 peripheral nerve | soft tissue 2 chondrocytes | soft tissue 2 fibroblasts | soft tissue 2 peripheral nerve | spleen cells in red pulp | spleen cells in white pulp | stomach 1 glandular cells | stomach 2 glandular cells | testis Leydig cells | testis cells in seminiferous ducts | testis elongated or late spermatids | testis pachytene spermatocytes | testis peritubular cells | testis preleptotene spermatocytes | testis round or early spermatids | testis sertoli cells | testis spermatogonia cells | thyroid gland glandular cells | tonsil germinal center cells | tonsil non-germinal center cells | tonsil squamous epithelial cells | urinary bladder urothelial cells | vagina squamous epithelial cells | off_target_id | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | ENSG00000107485 | GATA3 | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Not detected | Not detected | High | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Medium | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | High | NaN | Medium | Low | High | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Medium | Not detected | NaN | NaN | Medium | Not detected | Medium | Medium | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | Medium | Medium | Not detected | Low | Not detected | NaN | Not detected | Not detected | Not detected | Medium | NaN | Not detected | NaN | Not detected | Not detected | NaN | Medium | Medium | Not detected | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | High | Low | 1 |
| 1 | ENSG00000130755 | GMFG | Low | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Medium | NaN | Low | Not detected | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Medium | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Medium | NaN | Medium | NaN | Medium | Not detected | NaN | Low | NaN | NaN | NaN | Low | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | Medium | Low | Medium | Medium | Not detected | NaN | NaN | NaN | NaN | Low | NaN | Medium | Not detected | Not detected | Medium | NaN | Medium | Medium | NaN | NaN | NaN | NaN | Not detected | Low | Medium | NaN | NaN | NaN | Medium | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | NaN | Low | Medium | Medium | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | Not detected | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | Medium | Medium | NaN | Medium | Medium | Not detected | Not detected | Medium | Medium | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Not detected | Medium | Medium | Not detected | 100 |
| 2 | ENSG00000011677 | GABRA3 | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Low | NaN | NaN | Not detected | Not detected | Not detected | NaN | Low | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Low | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | 103 |
| 3 | ENSG00000141376 | BCAS3 | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Medium | Not detected | Medium | Medium | Not detected | Medium | Not detected | Medium | Not detected | Not detected | NaN | Medium | Medium | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | NaN | Not detected | NaN | Medium | Not detected | NaN | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | Medium | Medium | Medium | Medium | Low | Low | Not detected | Not detected | Not detected | NaN | Low | Medium | Low | Low | High | NaN | Medium | Medium | NaN | NaN | NaN | NaN | Medium | Medium | Low | NaN | NaN | NaN | Low | Medium | Low | Not detected | Medium | Not detected | Not detected | Not detected | Not detected | NaN | Low | Medium | Not detected | Medium | Medium | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | Low | Low | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Low | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Low | Not detected | Medium | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Low | Low | Medium | Low | 106 |
| 4 | ENSG00000104043 | ATP8B4 | Not detected | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | High | NaN | Low | NaN | Medium | Not detected | Medium | High | NaN | NaN | NaN | NaN | NaN | NaN | High | Low | High | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Medium | NaN | Medium | NaN | Medium | Medium | NaN | High | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Low | High | Low | Medium | Medium | Medium | NaN | NaN | NaN | NaN | Medium | NaN | High | Low | Low | Medium | NaN | Medium | Medium | NaN | NaN | NaN | NaN | Low | Medium | Medium | NaN | NaN | NaN | High | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | High | Medium | NaN | Not detected | High | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | High | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Medium | Low | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | High | NaN | Medium | NaN | Medium | Medium | Medium | High | Medium | High | High | High | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | Medium | Medium | Low | 110 |
| 5 | ENSG00000079263 | SP140 | Not detected | NaN | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Medium | NaN | Not detected | NaN | Medium | Low | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Medium | Not detected | Not detected | Not detected | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | Medium | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | NaN | Not detected | Not detected | Low | Medium | Not detected | Not detected | Low | NaN | Not detected | High | Not detected | Not detected | High | Not detected | Not detected | Not detected | Medium | High | Not detected | Not detected | Not detected | 112 |
| 6 | ENSG00000175048 | ZDHHC14 | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Low | NaN | Not detected | NaN | Not detected | NaN | Not detected | High | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | High | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Medium | Not detected | NaN | Medium | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Not detected | Medium | Not detected | Not detected | Not detected | Low | Not detected | Not detected | Low | Not detected | NaN | Not detected | Not detected | Not detected | High | Not detected | NaN | Not detected | High | NaN | NaN | NaN | NaN | Not detected | Medium | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | NaN | Not detected | Low | Not detected | Low | Not detected | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Low | Medium | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Low | Low | Medium | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Low | Not detected | Low | Not detected | Not detected | Not detected | Medium | Not detected | 113 |
| 7 | ENSG00000078114 | NEBL | Not detected | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Low | Not detected | NaN | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | Low | Not detected | Low | Low | Not detected | NaN | NaN | NaN | NaN | Low | NaN | Medium | High | Not detected | Not detected | NaN | Not detected | Low | NaN | NaN | NaN | NaN | Not detected | Medium | Not detected | NaN | NaN | NaN | Low | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Not detected | Not detected | Medium | Low | Low | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Low | Not detected | Medium | Medium | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | High | Low | Low | Low | Not detected | Low | Not detected | 115 |
| 8 | ENSG00000138653 | NDST4 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | 119 |
| 9 | ENSG00000188822 | CNR2 | Low | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | High | NaN | Low | NaN | Medium | Not detected | High | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Low | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Low | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Medium | NaN | Not detected | NaN | Medium | Medium | NaN | Medium | NaN | NaN | NaN | High | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Not detected | Medium | Not detected | Medium | Medium | Medium | NaN | NaN | NaN | NaN | Medium | NaN | Medium | Low | Not detected | Medium | NaN | Low | Medium | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Medium | High | High | NaN | NaN | NaN | NaN | NaN | NaN | Medium | High | NaN | Low | Medium | Low | High | NaN | NaN | Medium | NaN | NaN | NaN | NaN | Medium | Low | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | Medium | Not detected | NaN | NaN | Not detected | Not detected | Low | Medium | High | High | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | High | High | High | High | Low | 127 |
| 10 | ENSG00000137509 | PRCP | Not detected | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Low | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Medium | Medium | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | Medium | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Medium | Medium | NaN | Not detected | NaN | Not detected | Not detected | NaN | Medium | NaN | NaN | NaN | Not detected | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Medium | Medium | Not detected | Medium | Medium | Not detected | NaN | NaN | NaN | NaN | Medium | NaN | Not detected | Not detected | Medium | Medium | NaN | Not detected | High | NaN | NaN | NaN | NaN | Not detected | Medium | Not detected | NaN | NaN | NaN | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Not detected | Not detected | Not detected | Medium | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | Not detected | Medium | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Not detected | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Low | Not detected | Not detected | Not detected | NaN | Not detected | Low | High | Not detected | Low | Not detected | Medium | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Low | Not detected | Medium | Low | Low | Low | Low | Not detected | 132 |
| 11 | ENSG00000162813 | BPNT1 | Medium | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Not detected | NaN | Medium | Medium | Medium | Medium | Low | Medium | Not detected | Medium | Medium | Low | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Not detected | NaN | Not detected | NaN | Medium | Medium | NaN | Medium | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Low | Medium | Not detected | Medium | Medium | High | Not detected | Not detected | Medium | Medium | NaN | Not detected | High | Medium | Not detected | Low | NaN | Low | High | NaN | NaN | NaN | NaN | Not detected | Low | Medium | NaN | NaN | NaN | Medium | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | Medium | Low | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | Low | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Medium | High | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | High | Medium | Medium | Medium | Medium | Medium | Medium | Not detected | Not detected | Medium | Medium | High | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Not detected | Not detected | High | Medium | 133 |
| 12 | ENSG00000008282 | SYPL1 | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | High | NaN | Medium | Not detected | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Low | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Not detected | NaN | Low | NaN | Medium | Not detected | NaN | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Not detected | Medium | Not detected | Medium | Medium | Medium | NaN | NaN | NaN | NaN | High | NaN | High | Low | Not detected | Low | NaN | Medium | High | NaN | NaN | NaN | NaN | Medium | Low | Medium | NaN | NaN | NaN | Low | High | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | NaN | Low | Medium | Low | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Medium | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Low | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Low | Not detected | Low | Not detected | NaN | Low | Not detected | Medium | High | High | High | Medium | NaN | High | High | Not detected | Medium | High | Not detected | Medium | Medium | High | Medium | Medium | High | Low | 134 |
| 13 | ENSG00000163618 | CADPS | Not detected | NaN | NaN | NaN | Not detected | NaN | High | Not detected | Not detected | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Low | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | NaN | NaN | High | Not detected | Not detected | High | Not detected | Not detected | Medium | Medium | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Medium | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Low | High | High | Low | NaN | Not detected | NaN | NaN | Not detected | High | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Low | Not detected | Low | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Low | High | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | High | Not detected | Low | Not detected | Not detected | NaN | Not detected | Not detected | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | NaN | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | High | Not detected | NaN | Not detected | NaN | Not detected | High | Not detected | Not detected | Not detected | NaN | NaN | Not detected | Medium | Not detected | Not detected | Low | Medium | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | 140 |
| 14 | ENSG00000130021 | PUDP | Low | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Medium | NaN | Low | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Low | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Low | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Low | NaN | Not detected | NaN | Low | Not detected | NaN | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | Low | Not detected | Medium | Not detected | Not detected | NaN | NaN | NaN | NaN | Medium | NaN | Medium | Medium | Not detected | Low | NaN | Low | High | NaN | NaN | NaN | NaN | Low | Medium | NaN | Not detected | Medium | Not detected | Medium | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Medium | Not detected | Medium | Medium | High | NaN | NaN | Low | NaN | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Low | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | Not detected | Medium | NaN | NaN | NaN | Not detected | Low | Medium | Medium | Medium | High | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Not detected | Not detected | Not detected | Medium | Not detected | 141 |
| 15 | ENSG00000188906 | LRRK2 | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Low | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Low | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Low | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Low | Not detected | Not detected | NaN | Not detected | High | NaN | NaN | NaN | NaN | Low | Low | Medium | NaN | NaN | NaN | Low | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Low | Not detected | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Low | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Low | Not detected | Low | Not detected | Not detected | 142 |
| 16 | ENSG00000131149 | GSE1 | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Low | NaN | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | High | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Not detected | Low | NaN | Not detected | NaN | NaN | Medium | NaN | Medium | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Medium | Low | NaN | NaN | NaN | NaN | Medium | NaN | Low | Not detected | Not detected | Not detected | NaN | Medium | Low | NaN | NaN | NaN | NaN | Not detected | Not detected | Low | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | High | Low | Not detected | Not detected | Low | Low | Not detected | NaN | NaN | High | NaN | NaN | NaN | NaN | High | Low | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Not detected | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Low | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Not detected | NaN | Not detected | NaN | NaN | Not detected | NaN | Not detected | NaN | Not detected | Low | Not detected | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Not detected | Medium | Not detected | Medium | 15 |
| 17 | ENSG00000159216 | RUNX1 | Not detected | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | Low | NaN | Medium | NaN | Medium | Not detected | Medium | Medium | Medium | Medium | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Low | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Low | NaN | Not detected | NaN | Medium | Not detected | NaN | Not detected | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Low | Low | Low | Low | Low | Not detected | Medium | Not detected | Not detected | Not detected | NaN | Not detected | Low | Low | Not detected | Low | NaN | Not detected | Low | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | Medium | Medium | Not detected | Medium | Medium | Medium | High | High | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Low | Not detected | Low | Not detected | NaN | NaN | Medium | NaN | NaN | NaN | NaN | Low | Low | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | High | Not detected | Not detected | NaN | Low | Medium | NaN | Not detected | High | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Low | NaN | Not detected | High | Not detected | NaN | Not detected | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | Medium | Not detected | NaN | Not detected | NaN | Medium | Low | Medium | Medium | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | Medium | Medium | Medium | Low | 16 |
| 18 | ENSG00000124942 | AHNAK | Medium | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Low | NaN | Low | NaN | Medium | High | High | High | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Low | Not detected | NaN | Low | NaN | High | NaN | NaN | Medium | NaN | NaN | NaN | Medium | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | High | High | High | High | Medium | High | NaN | NaN | NaN | NaN | High | NaN | High | Medium | Low | Low | NaN | High | High | NaN | NaN | NaN | NaN | Medium | Low | Medium | NaN | NaN | NaN | Medium | Low | High | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | High | Medium | Medium | Not detected | Medium | NaN | NaN | High | NaN | NaN | NaN | NaN | High | High | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | High | Medium | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | High | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Medium | NaN | Medium | Medium | NaN | High | NaN | High | High | High | Medium | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | High | High | High | High | 20 |
| 19 | ENSG00000184903 | IMMP2L | Medium | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Medium | NaN | Medium | Low | High | Low | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Medium | Medium | NaN | Medium | NaN | High | High | NaN | Medium | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Low | High | Not detected | Medium | High | Medium | NaN | NaN | NaN | NaN | High | NaN | Medium | Medium | Low | Medium | NaN | Low | Medium | NaN | NaN | NaN | NaN | Low | Medium | Medium | NaN | NaN | NaN | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | High | Medium | Medium | Medium | High | NaN | NaN | Medium | NaN | NaN | NaN | NaN | High | High | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | High | Low | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | Medium | Medium | Medium | NaN | Medium | Medium | Medium | Medium | Medium | Medium | High | NaN | High | High | Not detected | Medium | High | Low | Medium | Medium | Medium | High | High | Medium | Medium | 21 |
| 20 | ENSG00000075340 | ADD2 | Not detected | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Low | NaN | High | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | NaN | NaN | Not detected | Not detected | Low | Not detected | Not detected | Not detected | Medium | Medium | Not detected | High | Not detected | Not detected | Not detected | Low | Low | NaN | High | NaN | Low | Not detected | NaN | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Low | NaN | Not detected | Not detected | Not detected | Medium | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | Not detected | Low | NaN | Not detected | Low | Not detected | Not detected | Not detected | Not detected | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Low | Not detected | Low | Not detected | 24 |
| 21 | ENSG00000101333 | PLCB4 | Not detected | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Low | Low | Low | Low | Not detected | NaN | Not detected | Medium | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Low | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Medium | NaN | Low | NaN | Not detected | Low | NaN | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Medium | Not detected | Not detected | Not detected | Medium | Medium | NaN | Not detected | Low | Low | Not detected | Low | NaN | Not detected | Low | NaN | NaN | NaN | NaN | Not detected | Low | Not detected | NaN | NaN | NaN | Low | Not detected | Medium | Not detected | Low | Not detected | Not detected | Medium | Medium | NaN | Not detected | NaN | Not detected | Medium | Low | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | Not detected | Low | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | Low | Not detected | Low | Not detected | Low | Low | High | Not detected | Low | Not detected | Not detected | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Low | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Medium | Not detected | Medium | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Low | Medium | Low | Low | Not detected | 27 |
| 22 | ENSG00000125354 | SEPTIN6 | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | High | NaN | High | Not detected | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | High | Not detected | Low | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Low | NaN | Low | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Not detected | Low | Not detected | Low | Medium | Not detected | NaN | NaN | NaN | NaN | Medium | NaN | High | Not detected | Not detected | Low | NaN | Not detected | High | NaN | NaN | NaN | NaN | High | Medium | Not detected | NaN | NaN | NaN | Medium | High | High | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | NaN | Not detected | Not detected | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Medium | High | High | High | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | High | High | Not detected | Medium | Not detected | 28 |
| 23 | ENSG00000197969 | VPS13A | Medium | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Low | NaN | Low | Low | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Low | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Low | Low | NaN | Low | NaN | NaN | Low | NaN | Medium | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | Low | Not detected | Medium | Medium | Low | NaN | NaN | NaN | NaN | Low | NaN | Medium | Medium | Low | Medium | NaN | Low | High | NaN | NaN | NaN | NaN | Not detected | Medium | NaN | Medium | Medium | Medium | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | NaN | Not detected | Low | Medium | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | Low | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Low | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Low | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | Low | NaN | NaN | Low | NaN | Medium | Low | Medium | Medium | High | NaN | Not detected | High | Not detected | Not detected | Not detected | High | High | Low | Medium | Low | Low | Medium | Not detected | 3 |
| 24 | ENSG00000140464 | PML | High | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Low | NaN | High | High | High | Medium | High | Medium | Not detected | Not detected | Not detected | High | NaN | Low | Low | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Low | Low | NaN | Not detected | NaN | NaN | Low | NaN | High | NaN | NaN | NaN | Medium | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Low | Low | Low | High | Medium | Medium | High | Not detected | Not detected | Not detected | NaN | High | High | Low | Low | Low | NaN | High | Medium | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | Medium | Medium | Not detected | Low | High | High | High | High | Not detected | Not detected | Not detected | High | NaN | High | NaN | Medium | Low | Not detected | Not detected | NaN | NaN | High | NaN | NaN | NaN | NaN | Medium | Low | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Medium | Not detected | NaN | NaN | Medium | Not detected | Not detected | Not detected | NaN | High | Not detected | NaN | Not detected | Low | NaN | Not detected | High | High | NaN | High | NaN | High | Not detected | High | High | NaN | High | NaN | Not detected | High | High | High | High | High | High | High | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | Low | High | High | NaN | High | Low | High | High | High | High | High | NaN | High | Not detected | Not detected | Not detected | Not detected | High | Not detected | High | Medium | High | High | High | High | 31 |
| 25 | ENSG00000168502 | MTCL1 | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Not detected | NaN | Low | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Medium | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Low | NaN | Not detected | NaN | Not detected | Medium | NaN | Low | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | Low | Not detected | Low | Medium | Medium | NaN | NaN | NaN | NaN | Medium | NaN | Medium | Medium | Not detected | Low | NaN | Not detected | Medium | NaN | NaN | NaN | NaN | Low | Medium | Medium | NaN | NaN | NaN | Not detected | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | NaN | Not detected | Low | Low | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | Low | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | Low | Not detected | NaN | NaN | Low | NaN | Not detected | Not detected | Medium | Medium | Low | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Low | Not detected | Medium | Medium | Medium | 33 |
| 26 | ENSG00000114107 | CEP70 | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Medium | NaN | Medium | Low | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | High | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | High | NaN | Not detected | NaN | Medium | Medium | NaN | Medium | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | Medium | Not detected | Medium | Medium | Medium | NaN | NaN | NaN | NaN | Medium | NaN | Medium | Medium | Low | Medium | NaN | Medium | High | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | Medium | Medium | Medium | Medium | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | NaN | Low | High | Medium | Medium | NaN | Medium | NaN | High | Not detected | High | Medium | NaN | Medium | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | High | NaN | NaN | Medium | Not detected | Medium | Medium | NaN | Medium | Not detected | NaN | Medium | NaN | NaN | Medium | Medium | Medium | NaN | Not detected | NaN | Medium | Low | Medium | Medium | Medium | Medium | NaN | Not detected | Medium | NaN | Medium | Medium | Medium | NaN | Not detected | NaN | NaN | NaN | NaN | High | NaN | NaN | Medium | Medium | Not detected | Not detected | Medium | NaN | NaN | Not detected | Low | Medium | High | Medium | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Medium | Medium | Medium | Medium | Medium | High | Medium | Medium | 34 |
| 27 | ENSG00000198252 | STYX | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Medium | Not detected | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Medium | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Low | NaN | Low | NaN | Low | Not detected | NaN | Not detected | NaN | NaN | NaN | Low | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Low | Low | NaN | NaN | NaN | NaN | Low | NaN | Medium | Medium | Not detected | Low | NaN | Not detected | Medium | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Medium | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Medium | Not detected | Low | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Low | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Low | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Low | Not detected | Low | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | Not detected | Low | Low | 35 |
| 28 | ENSG00000197892 | KIF13B | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Not detected | NaN | Not detected | Not detected | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Low | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Medium | NaN | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Medium | Not detected | Medium | Medium | Low | NaN | NaN | NaN | NaN | Low | NaN | Medium | Not detected | Not detected | Low | Not detected | Not detected | NaN | Medium | Not detected | Low | High | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | High | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Medium | Medium | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Low | Medium | Not detected | Not detected | Low | Medium | Medium | 37 |
| 29 | ENSG00000053108 | FSTL4 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | 38 |
| 30 | ENSG00000183638 | RP1L1 | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | High | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | 4 |
| 31 | ENSG00000150471 | ADGRL3 | Low | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Medium | NaN | Medium | Low | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Medium | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Low | Medium | NaN | Low | NaN | Medium | Medium | NaN | Low | NaN | NaN | NaN | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Not detected | Medium | Not detected | Low | Medium | Medium | NaN | NaN | NaN | NaN | High | NaN | High | Medium | Low | Medium | NaN | Low | Medium | NaN | NaN | NaN | NaN | Medium | Medium | Low | NaN | NaN | NaN | High | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | High | High | Low | Low | Medium | Medium | Medium | NaN | NaN | High | NaN | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Low | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Low | NaN | Medium | Medium | NaN | Medium | Low | Low | Low | High | High | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Medium | Medium | High | Medium | 42 |
| 32 | ENSG00000114455 | HHLA2 | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | NaN | High | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | High | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | High | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | 43 |
| 33 | ENSG00000156687 | UNC5D | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | 45 |
| 34 | ENSG00000137801 | THBS1 | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Medium | NaN | Medium | Not detected | Low | High | Low | Not detected | Not detected | Medium | Not detected | Not detected | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Not detected | NaN | Not detected | NaN | Medium | Low | NaN | Medium | NaN | NaN | NaN | High | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Medium | Low | Low | Low | High | Low | Low | Not detected | High | Not detected | NaN | Low | High | High | Not detected | Not detected | NaN | Medium | Medium | NaN | NaN | NaN | NaN | Not detected | Not detected | Low | NaN | NaN | NaN | Medium | High | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | Low | High | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | High | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | High | NaN | Low | Low | NaN | Not detected | NaN | High | Medium | High | High | Medium | NaN | Medium | Not detected | Not detected | Not detected | Not detected | Medium | Not detected | Low | Medium | Medium | Low | Medium | Low | 46 |
| 35 | ENSG00000033327 | GAB2 | Medium | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Low | NaN | Medium | Not detected | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Low | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | Low | NaN | Medium | NaN | Medium | Low | NaN | Medium | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | Medium | Medium | Medium | Medium | Medium | NaN | NaN | NaN | NaN | Medium | NaN | Medium | Medium | Medium | Medium | NaN | Medium | Medium | NaN | NaN | NaN | NaN | Low | Medium | Low | NaN | NaN | NaN | Medium | Low | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | Medium | Medium | Low | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | High | NaN | NaN | High | NaN | Medium | Medium | Medium | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | Medium | Medium | Medium | 48 |
| 36 | ENSG00000151892 | GFRA1 | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | High | NaN | Not detected | NaN | Low | Not detected | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | NaN | Low | NaN | NaN | NaN | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Not detected | Medium | Not detected | Medium | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Medium | Medium | Not detected | Not detected | NaN | Low | Medium | NaN | NaN | NaN | NaN | Not detected | Medium | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Low | Low | NaN | NaN | Medium | NaN | NaN | NaN | NaN | Not detected | Medium | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Low | Not detected | Not detected | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Medium | Not detected | Not detected | Not detected | Not detected | 49 |
| 37 | ENSG00000160207 | HSF2BP | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Low | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Medium | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Low | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | High | Low | Not detected | Not detected | Low | Low | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Low | Not detected | Low | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | 52 |
| 38 | ENSG00000151952 | TMEM132D | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | 54 |
| 39 | ENSG00000163781 | TOPBP1 | High | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | High | High | High | High | NaN | NaN | NaN | NaN | NaN | NaN | High | High | High | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | High | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | High | High | NaN | Low | NaN | High | High | NaN | High | NaN | NaN | NaN | High | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | High | High | High | High | High | High | NaN | NaN | NaN | NaN | High | NaN | High | High | High | High | NaN | High | High | NaN | NaN | NaN | NaN | Medium | Medium | High | NaN | NaN | NaN | High | High | High | NaN | NaN | NaN | NaN | NaN | NaN | High | High | High | Medium | High | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | High | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | High | High | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | High | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | High | NaN | High | NaN | High | High | High | High | High | High | High | Medium | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | High | High | High | High | High | 57 |
| 40 | ENSG00000144642 | RBMS3 | Medium | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Low | Low | High | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | High | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | High | NaN | Low | NaN | Not detected | Not detected | NaN | Medium | NaN | NaN | NaN | Not detected | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Not detected | Not detected | Low | Not detected | Medium | Not detected | NaN | NaN | NaN | NaN | Medium | NaN | Medium | Medium | Low | Medium | NaN | High | High | NaN | NaN | NaN | NaN | Medium | Not detected | Low | NaN | NaN | NaN | Medium | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | NaN | Medium | Low | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | High | High | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Medium | Medium | Medium | Medium | Medium | NaN | Low | Not detected | Not detected | Not detected | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Low | Not detected | Medium | Not detected | 60 |
| 41 | ENSG00000100412 | ACO2 | Not detected | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | High | NaN | Medium | NaN | High | Not detected | High | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | High | High | Not detected | High | Not detected | NaN | High | Not detected | Not detected | NaN | NaN | High | Not detected | Low | High | Not detected | Not detected | Not detected | Not detected | Not detected | High | High | Not detected | Low | High | High | NaN | Medium | NaN | High | NaN | NaN | Low | NaN | NaN | NaN | High | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | High | High | Medium | High | High | High | NaN | NaN | NaN | NaN | High | NaN | High | High | High | High | High | High | NaN | High | High | High | Not detected | High | Low | NaN | Medium | High | Medium | High | Medium | High | NaN | NaN | NaN | NaN | NaN | NaN | High | High | High | Medium | High | Medium | High | NaN | High | Low | Low | High | High | Medium | NaN | High | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | High | Medium | NaN | NaN | High | Not detected | High | High | NaN | High | Not detected | NaN | Not detected | NaN | NaN | High | High | High | NaN | High | Not detected | High | Not detected | High | High | NaN | High | NaN | Not detected | Medium | NaN | High | High | High | NaN | High | NaN | NaN | NaN | NaN | High | NaN | NaN | Medium | NaN | NaN | NaN | NaN | Not detected | Medium | High | High | High | Medium | High | NaN | Not detected | High | Not detected | Not detected | Not detected | High | High | High | NaN | High | High | High | High | 63 |
| 42 | ENSG00000079482 | OPHN1 | Low | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Medium | NaN | Medium | Not detected | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Low | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Medium | NaN | Not detected | NaN | Medium | NaN | NaN | Low | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | Medium | Not detected | Medium | Medium | Medium | NaN | NaN | NaN | NaN | Medium | NaN | Low | Low | Not detected | Low | NaN | Medium | Not detected | NaN | NaN | NaN | NaN | Low | Low | Medium | NaN | NaN | NaN | Medium | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Low | Low | Low | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Low | NaN | Low | Medium | NaN | Low | Low | Medium | Low | Medium | Medium | Low | NaN | Not detected | Not detected | Not detected | Not detected | High | Not detected | Not detected | Medium | Low | Not detected | Medium | Medium | Medium | 68 |
| 43 | ENSG00000019991 | HGF | Low | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Low | NaN | Low | Not detected | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Medium | Medium | NaN | Low | NaN | Medium | Low | NaN | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | Medium | Medium | Medium | Medium | Medium | NaN | NaN | NaN | NaN | Medium | NaN | Medium | Low | Low | Medium | NaN | Medium | Medium | NaN | NaN | NaN | NaN | Medium | Low | Low | NaN | NaN | NaN | Medium | Not detected | Low | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | NaN | Medium | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Not detected | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Low | NaN | Not detected | Low | Not detected | Not detected | Low | Low | Not detected | Medium | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | Medium | Medium | Low | 69 |
| 44 | ENSG00000103121 | CMC2 | Not detected | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Low | NaN | Not detected | Not detected | Low | Low | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Not detected | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Medium | NaN | Not detected | NaN | Low | Low | NaN | Low | NaN | NaN | NaN | Medium | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | Medium | Not detected | Medium | Medium | Medium | NaN | NaN | NaN | NaN | Medium | NaN | Medium | Medium | Low | Not detected | NaN | Not detected | Medium | NaN | NaN | NaN | NaN | Low | Medium | Low | NaN | NaN | NaN | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Low | Not detected | Not detected | Low | Low | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Low | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Low | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Medium | Medium | Medium | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | Medium | Medium | Medium | Low | 70 |
| 45 | ENSG00000135821 | GLUL | High | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Low | Not detected | Low | Not detected | Not detected | Low | Not detected | Not detected | Not detected | Not detected | NaN | High | Low | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | High | Medium | NaN | High | NaN | Not detected | Low | NaN | Low | NaN | NaN | NaN | Medium | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Not detected | Not detected | Not detected | Not detected | High | Low | Low | Not detected | Not detected | Not detected | NaN | Not detected | Low | Not detected | High | Low | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Medium | Not detected | NaN | NaN | NaN | Low | Not detected | Not detected | Not detected | Low | Not detected | Not detected | Not detected | Not detected | NaN | Low | Not detected | Low | Not detected | Low | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | High | Not detected | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Medium | Medium | High | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Not detected | Low | High | Low | 75 |
| 46 | ENSG00000072422 | RHOBTB1 | Medium | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | High | NaN | Medium | NaN | High | Medium | High | High | NaN | NaN | NaN | NaN | NaN | NaN | High | High | Medium | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | NaN | Medium | NaN | High | Medium | NaN | Medium | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Medium | High | Low | Medium | Medium | Medium | NaN | NaN | NaN | NaN | High | NaN | High | Medium | High | High | NaN | High | High | NaN | NaN | NaN | NaN | Medium | Medium | Medium | NaN | NaN | NaN | Medium | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | High | High | High | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Medium | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Medium | Medium | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | High | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Medium | NaN | High | Medium | Medium | High | NaN | Not detected | Low | High | High | High | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Medium | Medium | High | Medium | Medium | 76 |
| 47 | ENSG00000169764 | UGP2 | Low | NaN | NaN | NaN | Low | NaN | Not detected | Low | Not detected | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Not detected | Not detected | Low | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Medium | Not detected | Not detected | NaN | Not detected | Low | NaN | NaN | NaN | NaN | Not detected | High | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | Low | NaN | NaN | NaN | NaN | Low | Not detected | Not detected | NaN | Low | Not detected | Not detected | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Medium | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Low | NaN | Not detected | Not detected | Not detected | Medium | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Medium | NaN | Medium | Not detected | Not detected | Not detected | Low | Medium | Low | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | 80 |
| 48 | ENSG00000185303 | SFTPA2 | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | High | High | Not detected | High | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | 82 |
| 49 | ENSG00000086619 | ERO1B | Low | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | Not detected | NaN | Low | Not detected | Medium | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Medium | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Not detected | Low | NaN | Medium | NaN | Medium | Not detected | NaN | Low | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Low | Medium | Low | Not detected | High | Medium | NaN | NaN | NaN | NaN | Medium | NaN | Medium | Low | Low | Low | NaN | Low | Medium | NaN | NaN | NaN | NaN | Low | Medium | Low | NaN | NaN | NaN | Low | Low | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | NaN | Low | High | NaN | Low | NaN | NaN | Low | NaN | NaN | NaN | NaN | Low | Medium | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Medium | Low | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Low | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Low | Not detected | Low | Not detected | NaN | Not detected | Low | Low | Not detected | High | High | Low | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | Low | Low | Low | Low | Low | 86 |
| 50 | ENSG00000155719 | OTOA | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Medium | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | 91 |
| 51 | ENSG00000149503 | INCENP | Not detected | NaN | NaN | NaN | Low | NaN | High | Medium | Not detected | Medium | NaN | Medium | NaN | Medium | Medium | Not detected | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Low | Not detected | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Medium | High | Not detected | Medium | Not detected | Not detected | NaN | Medium | Medium | Not detected | High | Medium | NaN | Not detected | NaN | NaN | Medium | NaN | Not detected | Medium | Medium | Not detected | Not detected | Medium | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | Low | Low | Not detected | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | High | Medium | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Medium | NaN | Not detected | Not detected | Not detected | Not detected | NaN | Medium | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | High | Not detected | Medium | Not detected | Not detected | NaN | Medium | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Low | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Medium | NaN | Not detected | NaN | Medium | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Medium | Low | Not detected | Low | Low | NaN | Not detected | Medium | Not detected | Medium | Not detected | Not detected | Not detected | Not detected | High | Medium | Medium | Medium | Medium | 92 |
| 52 | ENSG00000183230 | CTNNA3 | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Medium | Not detected | Not detected | Not detected | NaN | Not detected | Not detected | Not detected | NaN | NaN | Not detected | Not detected | Low | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Medium | Not detected | Not detected | Not detected | Not detected | NaN | Not detected | NaN | Not detected | Not detected | NaN | Not detected | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | Low | NaN | Low | Medium | Low | Not detected | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | NaN | NaN | Not detected | NaN | Not detected | NaN | NaN | Not detected | NaN | Not detected | Not detected | Not detected | Not detected | Not detected | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Not detected | Not detected | Not detected | Not detected | Low | Not detected | 94 |
| 53 | ENSG00000126216 | TUBGCP3 | Low | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | Medium | NaN | High | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Low | Not detected | NaN | NaN | NaN | NaN | Low | NaN | NaN | NaN | Medium | Not detected | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Low | Not detected | Low | NaN | Medium | NaN | Medium | High | NaN | Low | NaN | NaN | NaN | High | NaN | NaN | Not detected | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Not detected | Low | Low | High | Medium | High | NaN | NaN | NaN | NaN | Medium | NaN | High | Medium | Low | Not detected | NaN | Low | High | NaN | NaN | NaN | NaN | Medium | High | Low | NaN | NaN | NaN | Not detected | High | High | NaN | NaN | NaN | NaN | NaN | NaN | High | High | NaN | Low | High | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | Medium | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | High | Medium | Low | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | Medium | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | High | NaN | NaN | Medium | NaN | NaN | NaN | Medium | NaN | NaN | Low | High | Medium | High | Medium | NaN | Medium | Not detected | Not detected | Low | Not detected | Not detected | Low | Medium | NaN | High | High | High | High | 98 |
| off_target_id | gene_ensembl_id | gene_symbol | Essential Genes | Splicing regulation | Spliceosome | RNA modification | 3' end processing | rRNA processing | Ribosome & basic translation | RNA stability & decay | microRNA processing | RNA localization | RNA export | Translation regulation | tRNA regulation | mitochondrial RNA regulation | Viral RNA regulation | snoRNA / snRNA / telomerase | P-body / stress granules | Exon Junction Complex | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 60 | ENSG00000144642 | RBMS3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| off_target_id | gene_ensembl_id | gene_symbol | Name | Somatic | Germline | Tumour Types(Somatic) | Tumour Types(Germline) | Molecular Genetics | Role in Cancer | |
|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 1 | ENSG00000107485 | GATA3 | GATA binding protein 3 | yes | NaN | breast | NaN | Rec | oncogene, TSG |
| 1 | 16 | ENSG00000159216 | RUNX1 | runt-related transcription factor 1 (AML1) | yes | NaN | AML, pre B-ALL, T-ALL | NaN | Dom | oncogene, TSG, fusion |
| 2 | 28 | ENSG00000125354 | SEPT6 | septin 6 | yes | NaN | AML | NaN | Dom | fusion |
| 3 | 31 | ENSG00000140464 | PML | promyelocytic leukemia | yes | NaN | APL, ALL | NaN | Dom | TSG, fusion |
| off_target_id | chromosome | start | end | strand | mismatch | dna | cr_rna | gene_ensembl_id | gene_type | gene_symbol | segment | mir_gene | pfam_protein_domains | targetscan | disease_related | inheritance_model | HumanTF_source | expression_information | rbp_gene_ensembl_id | cancer_related | remap_epd_gene_ensembl_id | remap_epd_disease_related | remap_epd_inheritance_model | remap_epd_cancer_related | enhancer_atlas_gene_ensembl_id | enhancer_atlas_disease_related | enhancer_atlas_inheritance_model | enhancer_atlas_cancer_related | risk_score | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 0 | 5 | 68208929 | 68208952 | - | 4 | AAAAAACAAAATCAGTGAATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 1 | 6 | 20 | 30730658 | 30730681 | - | 4 | AAGAATAAAAATTGATGAATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 2 | 7 | 21 | 9061991 | 9062014 | + | 4 | AAGAATAAAAATTGATGAATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 3 | 8 | 9 | 64065513 | 64065536 | + | 4 | AAGAATAAAAATTGATGAATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 4 | 9 | 14_GL000194v1_random | 47217 | 47240 | + | 4 | AAGAATAAAAATTGATGAATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 5 | 10 | Y | 4645389 | 4645412 | - | 4 | AAGAATCAAAATCCTTGAAATGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 6 | 11 | X | 91181637 | 91181660 | - | 4 | AAGAATCAAAATCCTTGAAATGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 7 | 12 | 6 | 87271027 | 87271050 | - | 4 | AAGAATCAACATCGTTGAAAGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 8 | 13 | 8 | 25724535 | 25724558 | - | 4 | AAGAATCAATATCAGTGAAATGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 9 | 14 | 13 | 86322610 | 86322633 | - | 4 | AAGAATCAATATCGTTGAAATGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 10 | 19 | 10 | 8808663 | 8808686 | - | 4 | ATCAATCAAATTCGGTGAATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 11 | 25 | 1 | 4888228 | 4888251 | - | 3 | GAAAAGCAAAATAGGTGAATGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 12 | 29 | 4 | 149997362 | 149997385 | - | 4 | GAAAATCAAAATGGGTTAGTAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 13 | 30 | 9 | 17903030 | 17903053 | - | 4 | GAAAATCAAATTAGTTGAATGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 14 | 32 | 1 | 21975854 | 21975877 | - | 4 | GAAAATGAAAATGGGTGATTGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 15 | 36 | 6 | 163822092 | 163822115 | - | 4 | GAAATTCGAAAACGGTGAATGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 16 | 40 | 14 | 54796468 | 54796491 | + | 4 | GAGAAACAAAATCGGAGCTTTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 17 | 41 | 2 | 215453094 | 215453117 | + | 4 | GAGAAACAAAATGGGAAAATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 18 | 44 | X | 117787022 | 117787045 | - | 4 | GAGAAACAGAATAAGTGAATAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 19 | 51 | 21 | 5997295 | 5997318 | + | 4 | GAGAACTAAAATAGGTTAATGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 20 | 53 | 20 | 21476782 | 21476805 | + | 3 | GAGAAGAAAAATCAGTGAATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 21 | 58 | 10 | 17805893 | 17805916 | - | 4 | GAGAAGCAGAATGGGTGTATGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 22 | 59 | 2 | 162891805 | 162891828 | - | 4 | GAGAAGCTACATAGGTGAATGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 23 | 61 | 1 | 19967519 | 19967542 | - | 4 | GAGAATCAAAACAGCAGAATAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 24 | 62 | 4 | 133351447 | 133351470 | - | 4 | GAGAATCAAAACCTGAGACTGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 25 | 66 | 1 | 215241122 | 215241145 | - | 4 | GAGAATCAAAATGAGTTATTTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 26 | 67 | 7 | 121721147 | 121721170 | - | 4 | GAGAATCAAAATTGTTAAAGTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 27 | 71 | 12 | 33913627 | 33913650 | - | 4 | GAGAATCAATATCGTTAAAATGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 28 | 72 | 1 | 46972533 | 46972556 | - | 4 | GAGAATCAATATCGTTAAAATGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 29 | 77 | 7 | 109776998 | 109777021 | + | 4 | GAGAATCCAAATCAGTAAAGGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 30 | 79 | 3 | 26863382 | 26863405 | + | 4 | GAGAATCTAATTCATTGAATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 31 | 81 | 8 | 6807804 | 6807827 | - | 4 | GAGAATGAAAACCAGTGCATCGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 32 | 84 | 20 | 61122747 | 61122770 | + | 4 | GAGAATGAAAATGGTTGAAACGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 33 | 89 | 1 | 168633592 | 168633615 | + | 4 | GAGAATTAAAATCAGCCAATGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 34 | 93 | 8 | 24218172 | 24218195 | + | 4 | GAGACACAAAATCAGTGAAGGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 35 | 96 | 2 | 121007545 | 121007568 | + | 4 | GAGACTGAGAATGGGTGAATGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 36 | 97 | 13_KI270838v1_alt | 292105 | 292128 | - | 4 | GAGAGCGAAAATCAGTGAATCGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 37 | 99 | 8 | 33276809 | 33276832 | - | 4 | GAGAGTCAAAAAGGGGGAATGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 38 | 101 | 3 | 25948324 | 25948347 | + | 4 | GAGATTCTAAATCTGTGTATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 39 | 102 | 16 | 31212022 | 31212045 | + | 4 | GAGATTTAAAATCAGGGAATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 40 | 104 | 7 | 21313185 | 21313208 | + | 4 | GAGCATCAGAAATGGTGAATAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 41 | 105 | 4 | 165639738 | 165639761 | + | 4 | GAGCATCCAAATCAGTAAATAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 42 | 111 | 3 | 24075070 | 24075093 | - | 4 | GAGCATCCAAATCGGTAAAGAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 43 | 116 | 14 | 48853799 | 48853822 | - | 4 | GATAATAAAAATCAGTGTATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 44 | 117 | 12 | 46121456 | 46121479 | - | 4 | GATAATAAAAATGAGTGAATGGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 45 | 118 | 6 | 113854393 | 113854416 | - | 4 | GATAATAATAATCGGTGTATAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 46 | 120 | 9 | 62840601 | 62840624 | - | 4 | GGAAATCCAAATCGGTGAAGAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 47 | 121 | 9 | 63779440 | 63779463 | + | 4 | GGAAATCCAAATCGGTGAAGAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 48 | 122 | 9 | 41276235 | 41276258 | - | 4 | GGAAATCGAAATCGGTGAAGAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 49 | 123 | 2 | 125967379 | 125967402 | + | 4 | GGAAATGAAAATAGGTGAATTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 50 | 128 | 16 | 75830134 | 75830157 | - | 4 | GGGCATCAAAATTGGTGAAGAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 51 | 129 | X | 55315831 | 55315854 | - | 4 | GGGCATCCAAATCGGTGAAGAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 52 | 130 | 12 | 87147601 | 87147624 | - | 4 | GGGCATCCAAATCGGTGAAGAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 53 | 135 | Y | 16783587 | 16783610 | + | 4 | TAGAATCAAAATAGCTGAACTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 54 | 138 | 2 | 7150543 | 7150566 | + | 4 | TAGAATCAGAATTGGTGACTAGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |
| 55 | 139 | 18 | 77854868 | 77854891 | - | 4 | TAGAATCAGAATTGGTGATTTGG | GAGAATCAAAATCGGTGAATNGG | NaN | [] | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | NaN | [] | NaN | NaN | [] | [] | NaN | NaN | [] | [] | [] | NaN |